Strain Name:
C57BL/6J-MtgxR5459Btlr/Mmmh
Stock Number:
043022-MU
Citation ID:
RRID:MMRRC_043022-MU
Other Names:
R5459 (G1), C57BL/6J-MtgxR5459Btlr
Major Collection:

Strain Information

Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Armc9
Name: armadillo repeat containing 9
Synonyms: 5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78795
Homologene: 11847
Polk
Name: polymerase (DNA directed), kappa
Synonyms: Dinb1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27015
VEGA: 13
HGNC: HGNC:9183
Homologene: 32140
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100929
Homologene: 7068
Tango6
Name: transport and golgi organization 6
Synonyms: Tmco7, Tango6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272538
Homologene: 52121
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Rasal2
Name: RAS protein activator like 2
Synonyms: A330066M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226525
HGNC: HGNC:9874
Homologene: 35217
Mcm3ap
Name: minichromosome maintenance complex component 3 associated protein
Synonyms: GANP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54387
VEGA: 10
HGNC: HGNC:6946
Homologene: 2902
2300002M23Rik
Name: RIKEN cDNA 2300002M23 gene
Synonyms: emprin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69542
Homologene: 49368
Neto2
Name: neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms: 5530601C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74513
Homologene: 32387
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50767
Homologene: 21333
Snx9
Name: sorting nexin 9
Synonyms: SH3PX1, SDP1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66616
VEGA: 17
Homologene: 49454
Stard3nl
Name: STARD3 N-terminal like
Synonyms: 0610035N01Rik, 6530409L22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76205
Homologene: 11501
Fbxw11
Name: F-box and WD-40 domain protein 11
Synonyms: HOS, BTRCP2, BTRC2, Fbxw1b, 2310065A07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103583
Homologene: 76444
Map4k3
Name: mitogen-activated protein kinase kinase kinase kinase 3
Synonyms: 9530052P13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225028
VEGA: 17
HGNC: HGNC:6865
Homologene: 2683
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, Catnd2, neurojugin, catenin (cadherin associated protein), delta 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Tnik
Name: TRAF2 and NCK interacting kinase
Synonyms: 4831440I19Rik, 1500031A17Rik, C530008O15Rik, C630040K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 665113
Homologene: 77943
Srp72
Name: signal recognition particle 72
Synonyms: 72kDa, 5730576P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66661
Homologene: 38254
Oog3
Name: oogenesin 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100012
Homologene: 129883
Slc27a2
Name: solute carrier family 27 (fatty acid transporter), member 2
Synonyms: FATP2, VLCS, FATP2, Vlacs, Vlac, ACSVL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26458
Homologene: 37830
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: LOC381663, A330009G12Rik, Sec63d1, Mer3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330149
Homologene: 87103
Spata31e2
Name: spermatogenesis associated 31 subfamily E member 2
Synonyms: 4931408C20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210940
Homologene: 86827
Zkscan3
Name: zinc finger with KRAB and SCAN domains 3
Synonyms: 2810435N07Rik, Skz1, Zfp307, Zfp306
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72739
Homologene: 130732
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Gpr179
Name: G protein-coupled receptor 179
Synonyms: 5330439C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217143
Homologene: 34917
Or4k39
Name: olfactory receptor family 4 subfamily K member 39, pseudogene 1
Synonyms: GA_x6K02T2Q125-72459956-72460837, MOR248-25_p, MOR248-17P, Olfr1285
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545447
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Mrp6, Dyscalc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Gpr87
Name: G protein-coupled receptor 87
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84111
HGNC: HGNC:4538
Homologene: 13021
Fcrla
Name: Fc receptor-like A
Synonyms: FCRL1, FREB, Fcrx, Freb1, mFREB, mFcrX
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98752
Homologene: 13106
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70381
Homologene: 9120
Hyal5
Name: hyaluronoglucosaminidase 5
Synonyms: 4933439A12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74468
Homologene: 50610
Megf11
Name: multiple EGF-like-domains 11
Synonyms: 2410080H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214058
Homologene: 13031
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Mcmdc2
Name: minichromosome maintenance domain containing 2
Synonyms: 6030422M02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240697
Homologene: 18309
Vmn1r19
Name: vomeronasal 1 receptor 19
Synonyms: V1rc27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171200
Homologene: 134034
Grep1
Name: glycine rich extracellular protein 1
Synonyms: 1520401A03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320309
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: A430041B07Rik, Fam179b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328108
VEGA: 12
Homologene: 15025
Siae
Name: sialic acid acetylesterase
Synonyms: LSE, clone 165, Ysg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22619
Homologene: 8001
Hs3st5
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Synonyms: LOC382362, D930005L05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319415
Homologene: 17796
Pdilt
Name: protein disulfide isomerase-like, testis expressed
Synonyms: PDILT, 1700007B13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71830
Homologene: 18382
Aloxe3
Name: arachidonate lipoxygenase 3
Synonyms: e-LOX-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23801
Homologene: 8013
Or5b95
Name: olfactory receptor family 5 subfamily B member 95
Synonyms: GA_x6K02T2RE5P-3006492-3007430, MOR202-8, Olfr1443
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258693
HGNC: HGNC:8324
Homologene: 115496
Gm26678
Name: predicted gene, 26678
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Myhas
Name: myosin heavy chain gene antisense RNA
Synonyms: Gm12300, lnc-mg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 102633540
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,937,084 bp
  • A to C, chromosome 1 at 26,685,191 bp
  • A to G, chromosome 1 at 46,109,312 bp
  • A to G, chromosome 1 at 59,191,738 bp
  • G to A, chromosome 1 at 86,207,972 bp
  • A to G, chromosome 1 at 157,157,661 bp
  • G to A, chromosome 1 at 170,918,169 bp
  • C to T, chromosome 2 at 111,409,018 bp
  • T to C, chromosome 2 at 126,580,992 bp
  • T to A, chromosome 3 at 28,661,741 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 3 at 54,634,100 bp
  • A to G, chromosome 3 at 59,179,727 bp
  • G to A, chromosome 4 at 144,159,245 bp
  • A to G, chromosome 5 at 76,984,338 bp
  • A to T, chromosome 5 at 89,691,473 bp
  • A to G, chromosome 5 at 106,904,763 bp
  • A to C, chromosome 5 at 130,274,706 bp
  • T to A, chromosome 5 at 144,207,416 bp
  • C to T, chromosome 6 at 24,891,251 bp
  • T to A, chromosome 6 at 57,404,490 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 45,982,183 bp
  • A to G, chromosome 7 at 119,486,935 bp
  • A to T, chromosome 8 at 3,535,829 bp
  • T to A, chromosome 8 at 85,670,483 bp
  • T to A, chromosome 8 at 106,850,289 bp
  • T to C, chromosome 9 at 37,616,823 bp
  • T to C, chromosome 9 at 59,884,520 bp
  • C to T, chromosome 9 at 64,686,329 bp
  • T to C, chromosome 10 at 36,828,746 bp
  • T to A, chromosome 10 at 76,496,482 bp
  • T to C, chromosome 11 at 32,739,191 bp
  • G to T, chromosome 11 at 67,211,283 bp
  • T to A, chromosome 11 at 69,132,828 bp
  • A to T, chromosome 11 at 97,336,657 bp
  • A to G, chromosome 12 at 64,967,736 bp
  • G to A, chromosome 13 at 19,373,199 bp
  • A to T, chromosome 13 at 21,394,812 bp
  • C to T, chromosome 13 at 96,495,476 bp
  • A to G, chromosome 14 at 67,235,201 bp
  • A to G, chromosome 15 at 30,887,188 bp
  • C to T, chromosome 17 at 5,920,638 bp
  • C to T, chromosome 17 at 23,711,843 bp
  • A to G, chromosome 17 at 35,568,182 bp
  • T to A, chromosome 17 at 80,609,787 bp
  • A to G, chromosome 19 at 12,680,435 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5459 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043022-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.