Strain Name:
C57BL/6J-MtgxR5690Btlr
Stock Number:
043323-MU
Citation ID:
RRID:MMRRC_043323-MU
Other Names:
R5690 (G1)
Major Collection:

Strain Information

Acadl
Name: acyl-Coenzyme A dehydrogenase, long-chain
Synonyms: LCAD, C79855
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11363
HGNC: HGNC:88
Homologene: 37498
Rab5if
Name: RAB5 interacting factor
Synonyms: 1110008F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67388
Homologene: 10315
Synj2
Name: synaptojanin 2
Synonyms: SJ2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20975
Homologene: 117703
Axin1
Name: axin 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12005
HGNC: HGNC:903
Homologene: 2614
Atp6v1e1
Name: ATPase, H+ transporting, lysosomal V1 subunit E1
Synonyms: H(+)-ATPase E-like protein, H+ ATPase subunit E, E2, Atp6e2, Atp6e, Atp6v1e, 2410029D23Rik, lysosomal 31kDa, D6Ertd385e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11973
HGNC: HGNC:857
Homologene: 1282
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Ap1s1
Name: adaptor protein complex AP-1, sigma 1
Synonyms: AP19
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11769
HGNC: HGNC:559
Homologene: 20342
Tubb3
Name: tubulin, beta 3 class III
Synonyms: 3200002H15Rik, betaIII-tubulin, Tuj1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22152
Homologene: 68503
Ncr1
Name: natural cytotoxicity triggering receptor 1
Synonyms: NKp46, MAR1 (mouse activating receptor 1), Ly94, Cd335
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17086
HGNC: HGNC:6731
Homologene: 3551
Ctsl
Name: cathepsin L
Synonyms: major excreted protein, MEP, Cat L, 1190035F06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13039
VEGA: 13
Homologene: 76699
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Tmc2
Name: transmembrane channel-like gene family 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192140
Homologene: 25877
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Dsg3
Name: desmoglein 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13512
VEGA: 18
HGNC: HGNC:3050
Homologene: 55513
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: 9330101J02Rik, Ttc40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Frmd4b
Name: FERM domain containing 4B
Synonyms: 6030440G05Rik, GRSP1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Tbx15
Name: T-box 15
Synonyms: Tbx8, de, Tbx14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21384
Homologene: 7967
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Slc8b1
Name: solute carrier family 8 (sodium/lithium/calcium exchanger), member B1
Synonyms: NCKX6, NCLX, Slc24a6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170756
Homologene: 41602
Fetub
Name: fetuin beta
Synonyms: 2310011O17Rik, D17980
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 59083
VEGA: 16
HGNC: HGNC:3658
Homologene: 8660
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: NG2, AN2, 4732461B14Rik, Cspg4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Efcab14
Name: EF-hand calcium binding domain 14
Synonyms: 4732418C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230648
Homologene: 8858
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Vmn1r19
Name: vomeronasal 1 receptor 19
Synonyms: V1rc27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171200
Homologene: 134034
Mrpl45
Name: mitochondrial ribosomal protein L45
Synonyms: 2600005P05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67036
Homologene: 32647
Pnpla1
Name: patatin-like phospholipase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433091
Homologene: 25324
Ogfod1
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 1
Synonyms: 4930415J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270086
Homologene: 41238
Vps16
Name: VSP16 CORVET/HOPS core subunit
Synonyms: 1810074M16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80743
Homologene: 7116
Trcg1
Name: taste receptor cell gene 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 541610
Homologene: 134171
C1s2
Name: complement component 1, s subcomponent 2
Synonyms: Gm5077
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 317677
HGNC: HGNC:1247
Homologene: 1314
4930533K18Rik
Name: RIKEN cDNA 4930533K18 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75189
VEGA: 10
Aqp7
Name: aquaporin 7
Synonyms: AQP7L, AQPap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11832
Homologene: 48000
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: mGk-16, Klk16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16615
Homologene: 68141
Tbx2
Name: T-box 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21385
Homologene: 38123
Slc22a12
Name: solute carrier family 22 (organic anion/cation transporter), member 12
Synonyms: Rst, URAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20521
Homologene: 56442
Thap4
Name: THAP domain containing 4
Synonyms: 2010320B01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67026
Homologene: 12075
Nt5c1a
Name: 5'-nucleotidase, cytosolic IA
Synonyms: Cn1a, LOC230718
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230718
Homologene: 57173
Rdh8
Name: retinol dehydrogenase 8
Synonyms: LOC235033, prRDH
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235033
VEGA: 9
Homologene: 41062
Ccer2
Name: coiled-coil glutamate-rich protein 2
Synonyms: Gm6537
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100504112
Homologene: 85749
Ak6
Name: adenylate kinase 6
Synonyms: 4921516M08Rik, 2810046E22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102216272
Homologene: 5540
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 40,537,112 bp
  • A to C, chromosome 1 at 66,640,572 bp
  • T to C, chromosome 1 at 66,853,286 bp
  • A to G, chromosome 1 at 93,716,630 bp
  • G to A, chromosome 2 at 20,805,836 bp
  • A to C, chromosome 2 at 40,750,894 bp
  • A to G, chromosome 2 at 130,232,386 bp
  • C to T, chromosome 2 at 130,439,091 bp
  • G to A, chromosome 2 at 156,865,314 bp
  • T to C, chromosome 3 at 99,308,850 bp
  • G to A, chromosome 4 at 41,035,510 bp
  • G to A, chromosome 4 at 115,760,047 bp
  • T to A, chromosome 4 at 123,215,939 bp
  • G to A, chromosome 5 at 120,513,205 bp
  • ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC, chromosome 5 at 137,037,379 bp
  • T to C, chromosome 6 at 57,404,795 bp
  • T to C, chromosome 6 at 97,353,203 bp
  • A to T, chromosome 6 at 120,808,356 bp
  • T to C, chromosome 6 at 124,631,037 bp
  • T to C, chromosome 6 at 149,328,237 bp
  • T to C, chromosome 7 at 4,338,297 bp
  • C to A, chromosome 7 at 28,756,204 bp
  • A to G, chromosome 7 at 44,140,894 bp
  • T to C, chromosome 7 at 56,157,705 bp
  • A to G, chromosome 7 at 139,638,353 bp
  • T to A, chromosome 8 at 94,058,141 bp
  • T to C, chromosome 8 at 123,421,306 bp
  • A to G, chromosome 9 at 20,825,489 bp
  • A to T, chromosome 9 at 56,898,735 bp
  • C to T, chromosome 9 at 57,241,811 bp
  • A to G, chromosome 10 at 70,923,314 bp
  • G to A, chromosome 10 at 107,777,117 bp
  • G to A, chromosome 10 at 128,484,407 bp
  • A to G, chromosome 11 at 67,329,275 bp
  • T to C, chromosome 11 at 69,491,544 bp
  • A to T, chromosome 11 at 85,837,053 bp
  • C to A, chromosome 11 at 97,321,586 bp
  • T to A, chromosome 12 at 13,336,284 bp
  • T to A, chromosome 13 at 64,365,208 bp
  • A to G, chromosome 13 at 100,655,621 bp
  • T to C, chromosome 14 at 57,590,989 bp
  • A to G, chromosome 15 at 85,112,773 bp
  • C to T, chromosome 16 at 22,932,331 bp
  • A to G, chromosome 17 at 6,035,527 bp
  • A to G, chromosome 17 at 26,194,937 bp
  • A to T, chromosome 17 at 28,878,372 bp
  • A to T, chromosome 18 at 20,522,051 bp
  • G to A, chromosome 18 at 37,490,484 bp
  • A to G, chromosome 19 at 6,536,848 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5690 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043323-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.