Strain Name:
B6J.129P2-Gt(ROSA)26SorTg(CAG-MCPyV_gp4)Cvp/Mmmh
Stock Number:
043602-MU
Citation ID:
RRID:MMRRC_043602-MU
Other Names:
ROSA26-CAG-LNL-MCVsTco,

Strain Information

CAG
Name: CMV early enhancer/chicken beta actin promoter/rabbit beta globin splice acceptor
Type: DNA Segment
Species: Multi-species
Chromosome:
Gt(ROSA)26Sor
Name: gene trap ROSA 26, Philippe Soriano
Synonyms: ROSA26, beta geo, Gtrgeo26, Gtrosa26, R26, Thumpd3as1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14910
MCPyV_gp4
Name: small T antigen [Merkel cell polyomavirus]
Type: Gene
Species: Virus
Chromosome:
Genetic Alterations

The wild-type Gt(ROSA)26Sor (Gene ID:14910) locus was displaced with the transgene. Note that the nucleotide sequence of MCV sT is codon-optimized as detailed below. The protein sequence, however, is identical to YP_009111422.1 that is linked to MCPyV_gp4 (Gene ID:10987419)

Codon-optimized MCV small T antigen open reading frame:

5'‑ATGGACTTGGTCCTTAACAGGAAAGAACGAGAGGCCCTGTGTAAGCTCTTGGAGATCGCTCCAAACTGTTACGGGAATATCCCTCTGATGAAGGCGGCATTCAAACGGTCATGTCTCAAACATCACCCAGATAAGGGTGGCAACCCTGTGATTATGATGGAACTGAATACCCTTTGGAGCAAGTTCCAGCAAAACATACACAAACTGAGGAGCGACTTCTCCATGTTTGATGAGGTGTCTACCAAGTTCCCCTGGGAGGAATATGGCACACTCAAAGATTACATGCAGAGTGGCTACAATGCTAGATTCTGCCGCGGACCCGGGTGCATGCTGAAACAACTGAGAGACAGCAAGTGCGCCTGTATCAGTTGTAAGCTTTCCCGGCAGCATTGCTCCCTGAAAACGTTGAAGCAGAAGAATTGCCTCACATGGGGAGAATGCTTTTGTTATCAGTGCTTCATTCTGTGGTTTGGATTTCCGCCCACTTGGGAGTCATTCGACTGGTGGCAGAAAACTCTGGAAGAAACCGACTATTGCTTGCTTCACTTGCATCTCTTCTGA‑3'

Genotype Determination
ES Cell Line
E14 derived from 129P2/OlaHsd
Phenotype

Homozygous: Not tested

Hetero/Hemizygous: High-dose of Tamoxifen induces chromosomal instability and lethality while low dose Tamoxifen shows hyperplasia of ear skin.

Cre-excised Phenotype: Undetermined 

Strain Development
Transgenic positive ES clones were injected into C57BL/6J chimeric. “Based on screening results and morphological criteria ES cell clones 184-E2, 188-F1, 206-Cr, 208-A5, 208-E2, 208-F1 and 208-G1 were injected into C57BL/6J blastocysts…7 highly chimeric males (chimerism rate about 50%) were generated. Clone 206-C4: 4 chimera. Clone 208-F1: 3 chimera."
Suggested Control Mice
Wild-type littermates
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
  • Cancer
  • Dermatology
  • Models for Human Disease
  • Research Tools
  • Virology
Donor
Patrick Moore, University of Pittsburgh Cancer Institute.
Yuan Chang, M.D, University of Pittsburgh Cancer Institute.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Sib-mating
Breeding Scheme(s)
Regular PCR genotyping
Generation
> 10 generations
Overall Breeding Performance
Excellent
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: 8 to 12 months 8 to 12 months
Bred to Homozygosity
No
Average litter size
5-9
Recommended wean age
3-4 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043602-MU-SPERM Cryo-preserved spermatozoa $437.00 / Non-Profit Aliquot Approximate quantity3
043602-MU-RESUS Litter recovered from cryo-archive $2,624.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.