Strain Name:
C57BL/6J-MtgxR6054Btlr/Mmmh
Stock Number:
044222-MU
Citation ID:
RRID:MMRRC_044222-MU
Other Names:
R6054 (G1)
Major Collection:

Strain Information

Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Dhx35
Name: DEAH-box helicase 35
Synonyms: Ddx35, 1200009D07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71715
Homologene: 6406
Wdr48
Name: WD repeat domain 48
Synonyms: 8430408H12Rik, Uaf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67561
VEGA: 9
Homologene: 10830
Idh3a
Name: isocitrate dehydrogenase 3 (NAD+) alpha
Synonyms: 1500012E04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67834
VEGA: 9
HGNC: HGNC:5384
Homologene: 4037
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Oga
Name: O-GlcNAcase
Synonyms: Hy5, 5830447M11Rik, 4833427O07Rik, 2810009A20Rik, Mgea5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76055
VEGA: 19
HGNC: HGNC:7056
Homologene: 8154
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64706
Homologene: 11224
Cd3e
Name: CD3 antigen, epsilon polypeptide
Synonyms: T3e, CD3, CD3epsilon
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12501
HGNC: HGNC:1674
Homologene: 586
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Efs
Name: embryonal Fyn-associated substrate
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13644
VEGA: 14
Homologene: 4284
Sema6a
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms: VIa, sema, Sema6A-1, Semaq, A730020P05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20358
Homologene: 32426
Leng8
Name: leukocyte receptor cluster (LRC) member 8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232798
Homologene: 13612
Zfp408
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381410
Homologene: 11687
Syt17
Name: synaptotagmin XVII
Synonyms: Bk
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110058
Homologene: 9553
Adh5
Name: alcohol dehydrogenase 5 (class III), chi polypeptide
Synonyms: Adh-5, Adh3, S-nitrosoglutathione reductase, GSNOR
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11532
HGNC: HGNC:253
Homologene: 68076
Brd9
Name: bromodomain containing 9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105246
VEGA: 13
Homologene: 82462
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: Bromi, C6orf170, D630037F22Rik, b2b2284Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Fbxl19
Name: F-box and leucine-rich repeat protein 19
Synonyms: Fbl19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233902
Homologene: 129692
Ccdc85c
Name: coiled-coil domain containing 85C
Synonyms: Gm9010, hhy
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668158
VEGA: 12
Homologene: 82238
Siglecf
Name: sialic acid binding Ig-like lectin F
Synonyms: mSiglec-F, Siglec5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233186
Homologene: 50482
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270118
Homologene: 134147
Col28a1
Name: collagen, type XXVIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213945
Homologene: 66345
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Zfp652
Name: zinc finger protein 652
Synonyms: 9530033F24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268469
Homologene: 54768
Pcdhb5
Name: protocadherin beta 5
Synonyms: Pcdhb4A, PcdhbE
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93876
HGNC: HGNC:8689
Homologene: 75103
Hrg
Name: histidine-rich glycoprotein
Synonyms: D16JH2, D18020
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94175
HGNC: HGNC:5181
Homologene: 137650
Mprip
Name: myosin phosphatase Rho interacting protein
Synonyms: RIP3, p116Rip, p116 Rho interacting protein, Rhoip3, Gm34094
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26936
Homologene: 9034
4930562C15Rik
Name: RIKEN cDNA 4930562C15 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78809
Homologene: 53527
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Rora
Name: RAR-related orphan receptor alpha
Synonyms: Nr1f1, 9530021D13Rik, tmgc26
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19883
Homologene: 56594
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435864
Homologene: 129606
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Atp6v0a1
Name: ATPase, H+ transporting, lysosomal V0 subunit A1
Synonyms: V-ATPase a1, Vpp1, Vpp-1, Atp6n1, Atp6n1a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11975
HGNC: HGNC:865
Homologene: 3795
Apoh
Name: apolipoprotein H
Synonyms: beta-2-glycoprotein 1, beta-2-GPI, B2GPI
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11818
HGNC: HGNC:616
Homologene: 26
Col16a1
Name: collagen, type XVI, alpha 1
Synonyms: [a]1 (XVI) collagen, 2700007F12Rik, A530052M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107581
HGNC: HGNC:2193
Homologene: 1397
Vrk2
Name: vaccinia related kinase 2
Synonyms: 2810003O05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69922
Homologene: 55966
Hps1
Name: HPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms: 6030422N11Rik, Hermansky-Pudlak syndrome 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 192236
HGNC: HGNC:5163
Homologene: 163
Ccs
Name: copper chaperone for superoxide dismutase
Synonyms: CCS, Ccsd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12460
VEGA: 19
HGNC: HGNC:1613
Homologene: 3762
Adam28
Name: a disintegrin and metallopeptidase domain 28
Synonyms: Dtgn1, MDC-L, D430033C21Rik, C130072N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13522
VEGA: 14
HGNC: HGNC:206
Homologene: 40705
Miip
Name: migration and invasion inhibitory protein
Synonyms: D4Wsu114e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 28010
Homologene: 15879
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: BPAg2, BP180, Bpag, Bpag2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Arrdc5
Name: arrestin domain containing 5
Synonyms: 1700013E09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76920
VEGA: 17
Homologene: 66277
Krtap4-22
Name: keratin associated protein 4-22
Synonyms: Gm11595
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100040276
Homologene: 124486
Adam4
Name: a disintegrin and metallopeptidase domain 4
Synonyms: tMDCV
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11498
Homologene: 86950
Efhb
Name: EF hand domain family, member B
Synonyms: 4921525D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211482
VEGA: 17
Homologene: 16982
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23897
Homologene: 4463
Or51b4
Name: olfactory receptor family 51 subfamily B member 4
Synonyms: 5'[b]1, MOR1-3, GA_x6K02T2PBJ9-6620959-6620024, Olfr66
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18367
Homologene: 88376
Hadha
Name: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha
Synonyms: Mtpa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 97212
HGNC: HGNC:4801
Homologene: 152
Or1ad1
Name: olfactory receptor family 1 subfamily AD member 1
Synonyms: GA_x6K02T2QP88-4453480-4452557, MOR129-1, Olfr1377
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258913
Homologene: 64929
Pramel6
Name: PRAME like 6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 347711
Homologene: 77635
Grxcr2
Name: glutaredoxin, cysteine rich 2
Synonyms: LOC332309
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 332309
VEGA: 18
Homologene: 85304
Spata31d1b
Name: spermatogenesis associated 31 subfamily D, member 1B
Synonyms: Fam75d1b, Gm4934
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238662
VEGA: 13
Pcdha2
Name: protocadherin alpha 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353234
HGNC: HGNC:8668
Homologene: 135719
Nmrk2
Name: nicotinamide riboside kinase 2
Synonyms: 2310015C21Rik, Itgb1bp3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69564
VEGA: 10
Homologene: 113783
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Whsc1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 6,249,834 bp
  • A to G, chromosome 2 at 87,508,659 bp
  • C to A, chromosome 2 at 91,649,291 bp
  • T to A, chromosome 2 at 158,818,299 bp
  • A to T, chromosome 3 at 83,346,236 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • A to G, chromosome 3 at 108,406,963 bp
  • A to G, chromosome 3 at 138,445,375 bp
  • G to A, chromosome 4 at 130,061,722 bp
  • A to G, chromosome 4 at 147,865,678 bp
  • A to G, chromosome 4 at 154,263,179 bp
  • T to C, chromosome 5 at 30,123,684 bp
  • T to C, chromosome 5 at 33,882,161 bp
  • T to A, chromosome 5 at 108,848,260 bp
  • G to A, chromosome 6 at 8,083,748 bp
  • T to C, chromosome 6 at 128,513,764 bp
  • C to A, chromosome 7 at 4,145,523 bp
  • T to A, chromosome 7 at 43,355,006 bp
  • A to G, chromosome 7 at 64,268,702 bp
  • T to C, chromosome 7 at 72,259,103 bp
  • A to G, chromosome 7 at 103,881,826 bp
  • T to C, chromosome 7 at 118,408,133 bp
  • C to T, chromosome 7 at 127,752,509 bp
  • T to G, chromosome 8 at 84,556,785 bp
  • TCAGCAGCAGCAGCAGCAGC to TCAGCAGCAGCAGCAGC, chromosome 9 at 13,621,399 bp
  • G to A, chromosome 9 at 45,002,161 bp
  • T to C, chromosome 9 at 53,459,873 bp
  • T to C, chromosome 9 at 54,586,545 bp
  • A to G, chromosome 9 at 69,378,802 bp
  • A to G, chromosome 9 at 119,907,777 bp
  • T to A, chromosome 10 at 39,824,150 bp
  • T to C, chromosome 10 at 56,162,208 bp
  • G to A, chromosome 10 at 81,199,634 bp
  • T to C, chromosome 10 at 107,582,358 bp
  • A to T, chromosome 11 at 26,486,975 bp
  • G to A, chromosome 11 at 50,984,804 bp
  • T to C, chromosome 11 at 59,758,425 bp
  • G to A, chromosome 11 at 95,749,863 bp
  • A to T, chromosome 11 at 99,772,648 bp
  • C to T, chromosome 11 at 101,039,889 bp
  • A to G, chromosome 11 at 108,395,975 bp
  • A to C, chromosome 12 at 81,420,054 bp
  • T to A, chromosome 12 at 108,274,769 bp
  • G to A, chromosome 13 at 38,167,609 bp
  • A to G, chromosome 13 at 59,715,650 bp
  • T to A, chromosome 13 at 73,940,741 bp
  • C to T, chromosome 14 at 54,921,157 bp
  • T to A, chromosome 14 at 68,642,152 bp
  • C to A, chromosome 15 at 83,651,676 bp
  • T to C, chromosome 16 at 4,835,865 bp
  • A to T, chromosome 16 at 22,953,662 bp
  • T to G, chromosome 16 at 29,615,134 bp
  • C to T, chromosome 17 at 53,398,999 bp
  • T to C, chromosome 17 at 56,294,420 bp
  • A to G, chromosome 18 at 36,940,804 bp
  • T to G, chromosome 18 at 37,321,080 bp
  • A to G, chromosome 18 at 41,986,678 bp
  • C to T, chromosome 18 at 47,283,403 bp
  • T to G, chromosome 18 at 49,857,386 bp
  • A to T, chromosome 19 at 4,825,865 bp
  • A to T, chromosome 19 at 42,770,778 bp
  • A to G, chromosome 19 at 45,776,132 bp
  • A to G, chromosome 19 at 47,680,420 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6054 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044222-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.