Strain Name:
C57BL/6J-MtgxR6582Btlr/Mmmh
Stock Number:
044706-MU
Citation ID:
RRID:MMRRC_044706-MU
Other Names:
R6582 (G1)
Major Collection:

Strain Information

Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Vsnl1
Name: visinin-like 1
Synonyms: VILIP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26950
VEGA: 12
Homologene: 2542
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4930435C18Rik, 4921507G06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Fbxw8
Name: F-box and WD-40 domain protein 8
Synonyms: FBXO29, Fbx29, FBW8, FBW6, 4930438M06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231672
Homologene: 17731
Flnb
Name: filamin, beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 286940
HGNC: HGNC:3755
Homologene: 37480
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Ywhaz
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Synonyms: 1110013I11Rik, 14-3-3 zeta
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22631
Homologene: 56528
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Mbd3l1
Name: methyl-CpG binding domain protein 3-like 1
Synonyms: 1700070G05Rik, Mbd3l, 1700095H13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73503
VEGA: 9
Homologene: 12502
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Col5a2
Name: collagen, type V, alpha 2
Synonyms: 1110014L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12832
HGNC: HGNC:2210
Homologene: 20119
Kcnj6
Name: potassium inwardly-rectifying channel, subfamily J, member 6
Synonyms: Kir3.2, GIRK2, KCNJ7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16522
VEGA: 16
HGNC: HGNC:6267
Homologene: 1688
Fyb2
Name: FYN binding protein 2
Synonyms: 1700024P16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242594
Homologene: 52981
Cenpt
Name: centromere protein T
Synonyms: G630055P03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320394
Homologene: 41610
Tas2r110
Name: taste receptor, type 2, member 110
Synonyms: T2R10, Tas2r10, STC 9-1, mt2r57
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387344
Homologene: 130069
Wdsub1
Name: WD repeat, SAM and U-box domain containing 1
Synonyms: 1700048E19Rik, 2610014F08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72137
Homologene: 17609
Neto1
Name: neuropilin (NRP) and tolloid (TLL)-like 1
Synonyms: C130005O10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246317
VEGA: 18
Homologene: 16367
Or52p1
Name: olfactory receptor family 52 subfamily P member 1
Synonyms: GA_x6K02T2PBJ9-7245486-7246451, MOR27-1, Olfr656
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259078
Homologene: 128072
Klri2
Name: killer cell lectin-like receptor family I member 2
Synonyms: A530090P03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320407
Homologene: 86736
Smarca5
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms: Snf2h, D330027N15Rik, 4933427E24Rik, D030040M08Rik, MommeD4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93762
Homologene: 55764
Ivl
Name: involucrin
Synonyms: 1110019C06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16447
HGNC: HGNC:6187
Homologene: 137207
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Or10j3
Name: olfactory receptor family 10 subfamily J member 3B
Synonyms: GA_x6K02SYWG4P-534-1100, GA_x6K02T2R7CC-643715-642847, MOR267-3, MOR267-3, Olfr1405-ps1, Olfr218
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258880
Homologene: 105155
Mark1
Name: MAP/microtubule affinity regulating kinase 1
Synonyms: Emk3, B930025N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226778
HGNC: HGNC:6896
Homologene: 49552
Gbp2b
Name: guanylate binding protein 2b
Synonyms: Mag-1, Mpa-1, Gbp-1, Mpa1, LIMIT, Gbp1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14468
Homologene: 137233
Pidd1
Name: p53 induced death domain protein 1
Synonyms: 1200011D09Rik, Pidd, Lrdd
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57913
Homologene: 11220
Or4a67
Name: olfactory receptor family 4 subfamily A member 67
Synonyms: GA_x6K02T2Q125-50243231-50242221, MOR225-12, Olfr1200
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257887
Homologene: 123770
Vmn1r71
Name: vomeronasal 1 receptor 71
Synonyms: V1re13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252910
Homologene: 74352
Acsm3
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sa, Sah
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20216
Homologene: 74559
Or52u1
Name: olfactory receptor family 52 subfamily U member 1
Synonyms: GA_x6K02T2PBJ9-7215221-7216195, MOR38-2, Olfr654
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258377
Homologene: 90859
Mcat
Name: malonyl CoA:ACP acyltransferase (mitochondrial)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223722
VEGA: 15
Homologene: 15511
Casp4
Name: caspase 4, apoptosis-related cysteine peptidase
Synonyms: ich-3, Caspase-11, Casp11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12363
Homologene: 136493
Gzmk
Name: granzyme K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14945
HGNC: HGNC:4711
Homologene: 20485
Abhd6
Name: abhydrolase domain containing 6
Synonyms: 0610041D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66082
VEGA: 14
Homologene: 23246
Asmt
Name: acetylserotonin O-methyltransferase
Synonyms: Hiomt
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 107626
VEGA: X
HGNC: HGNC:750
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 45,390,115 bp
  • T to C, chromosome 1 at 71,258,225 bp
  • G to T, chromosome 1 at 173,204,280 bp
  • G to A, chromosome 1 at 184,912,589 bp
  • T to C, chromosome 2 at 59,878,308 bp
  • A to T, chromosome 2 at 88,768,243 bp
  • C to A, chromosome 2 at 122,092,292 bp
  • CCTGCTGCTGCTGCT to CCTGCTGCTGCT, chromosome 3 at 92,571,910 bp
  • A to G, chromosome 3 at 142,611,040 bp
  • A to G, chromosome 4 at 104,945,542 bp
  • C to A, chromosome 5 at 118,124,963 bp
  • A to T, chromosome 6 at 129,739,133 bp
  • T to A, chromosome 6 at 132,868,285 bp
  • T to A, chromosome 7 at 10,748,681 bp
  • T to C, chromosome 7 at 104,588,011 bp
  • A to T, chromosome 7 at 104,618,441 bp
  • A to G, chromosome 7 at 119,779,673 bp
  • A to T, chromosome 7 at 141,439,581 bp
  • A to G, chromosome 7 at 141,696,698 bp
  • G to A, chromosome 8 at 80,719,652 bp
  • A to T, chromosome 8 at 105,849,201 bp
  • T to C, chromosome 8 at 122,891,629 bp
  • A to G, chromosome 9 at 5,324,884 bp
  • T to C, chromosome 9 at 18,484,728 bp
  • G to A, chromosome 9 at 45,752,806 bp
  • G to T, chromosome 11 at 66,061,097 bp
  • AGCGGCGGCGGCGGCGGCGG to AGCGGCGGCGGCGGCGG, chromosome 11 at 69,369,156 bp
  • A to G, chromosome 12 at 11,326,488 bp
  • A to G, chromosome 13 at 113,180,511 bp
  • T to G, chromosome 14 at 7,892,275 bp
  • G to T, chromosome 14 at 8,042,826 bp
  • T to G, chromosome 14 at 8,042,828 bp
  • G to T, chromosome 14 at 67,019,804 bp
  • T to C, chromosome 15 at 36,790,922 bp
  • T to C, chromosome 15 at 83,549,182 bp
  • A to G, chromosome 16 at 94,832,826 bp
  • CGGG to CGGGG, chromosome 17 at 3,414,622 bp
  • T to A, chromosome 18 at 12,577,840 bp
  • A to T, chromosome 18 at 86,494,860 bp
  • T to A, chromosome X at 170,675,031 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6582 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044706-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.