Strain Name:
C57BL/6J-MtgxR6629Btlr/Mmmh
Stock Number:
044751-MU
Citation ID:
RRID:MMRRC_044751-MU
Other Names:
R6629 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Rgs16
Name: regulator of G-protein signaling 16
Synonyms: Rgsr
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19734
HGNC: HGNC:9997
Homologene: 2196
Grin3a
Name: glutamate receptor ionotropic, NMDA3A
Synonyms: NMDAR-L, NR3A, A830097C19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242443
Homologene: 128613
Pxn
Name: paxillin
Synonyms: Pax
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19303
HGNC: HGNC:9718
Homologene: 37697
Lasp1
Name: LIM and SH3 protein 1
Synonyms: SH3P6, Def-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16796
HGNC: HGNC:6513
Homologene: 4480
Atxn3
Name: ataxin 3
Synonyms: Sca3, MJD1, 2210008M02Rik, ataxin-3, Mjd, Atx3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110616
HGNC: HGNC:7106
Homologene: 3658
Cacul1
Name: CDK2 associated, cullin domain 1
Synonyms: 2810417M16Rik, D130033C15Rik, 9830127L17Rik, 2700078E11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78832
VEGA: 19
Homologene: 17821
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Hook1
Name: hook microtubule tethering protein 1
Synonyms: abnormal spermatozoon head shape, azh, A930033L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77963
Homologene: 9289
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Eif5
Name: eukaryotic translation initiation factor 5
Synonyms: D12Ertd549e, 2810011H21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217869
VEGA: 12
HGNC: HGNC:3299
Homologene: 49610
Mllt3
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms: 3830408D16Rik, D4Ertd321e, Af9, 2210011H10Rik, 2610012I03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70122
HGNC: HGNC:7136
Homologene: 37933
Zp3
Name: zona pellucida glycoprotein 3
Synonyms: Zp-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22788
Homologene: 5178
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Prpf4
Name: pre-mRNA processing factor 4
Synonyms: 1600015H11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70052
Homologene: 3446
Wdr75
Name: WD repeat domain 75
Synonyms: 1300003A18Rik, 2410118I19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73674
Homologene: 32771
Tctn1
Name: tectonic family member 1
Synonyms: Tect1, G730031O11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 654470
Homologene: 49770
Plcxd2
Name: phosphatidylinositol-specific phospholipase C, X domain containing 2
Synonyms: EG433022
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 433022
Homologene: 44374
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Bnip2
Name: BCL2/adenovirus E1B interacting protein 2
Synonyms: 5730523P12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12175
HGNC: HGNC:1083
Homologene: 3194
Tspear
Name: thrombospondin type laminin G domain and EAR repeats
Synonyms: ORF65, C330046G03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 252974
HGNC: HGNC:1268
Homologene: 36972
Slc4a1
Name: solute carrier family 4 (anion exchanger), member 1
Synonyms: erythrocyte membrane protein band 3, band 3, Empb3, Ae1, CD233, l11Jus51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20533
Homologene: 133556
Rab44
Name: RAB44, member RAS oncogene family
Synonyms: 9830134C10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 442827
Homologene: 53300
Zfp652
Name: zinc finger protein 652
Synonyms: 9530033F24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268469
Homologene: 54768
Dlgap2
Name: DLG associated protein 2
Synonyms: SAP90/PSD-95-associated protein 2, PSD-95/SAP90-binding protein 2, 6430596N04Rik, DAP2, Sapap2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244310
HGNC: HGNC:2906
Homologene: 3484
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435626
Homologene: 52359
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Ccdc192
Name: coiled-coil domain containing 192
Synonyms: 1700011I03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75444
Homologene: 133296
Or4c116
Name: olfactory receptor family 4 subfamily C member 116
Synonyms: GA_x6K02T2Q125-50591144-50590209, MOR233-3, Olfr1221
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258904
Homologene: 73987
Rsbn1
Name: rosbin, round spermatid basic protein 1
Synonyms: Rsbp, C230004D03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229675
Homologene: 10154
Hectd2
Name: HECT domain E3 ubiquitin protein ligase 2
Synonyms: A630025O09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226098
Homologene: 6280
Gnrhr
Name: gonadotropin releasing hormone receptor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14715
HGNC: HGNC:4421
Homologene: 350
Vmn1r34
Name: vomeronasal 1 receptor 34
Synonyms: Gm5991
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546901
Homologene: 110800
Pla2g4f
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271844
Homologene: 77933
Meltf
Name: melanotransferrin
Synonyms: MTf, CD228, melanotransferrin, Mfi2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30060
VEGA: 16
HGNC: HGNC:7037
Homologene: 4335
Cpa2
Name: carboxypeptidase A2, pancreatic
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232680
HGNC: HGNC:2297
Homologene: 37541
Fam136b-ps
Name: family with sequence similarity 136, member B, pseudogene
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 625796
VEGA: 15
Rhobtb1
Name: Rho-related BTB domain containing 1
Synonyms: 1700008H16Rik, 3110048G13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69288
Homologene: 8892
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 45,812,056 bp
  • A to G, chromosome 1 at 74,132,367 bp
  • A to G, chromosome 1 at 153,743,674 bp
  • G to A, chromosome 2 at 13,430,872 bp
  • T to A, chromosome 2 at 89,112,162 bp
  • A to T, chromosome 2 at 120,308,242 bp
  • C to A, chromosome 3 at 98,120,881 bp
  • A to C, chromosome 3 at 103,928,441 bp
  • A to G, chromosome 4 at 49,844,991 bp
  • G to A, chromosome 4 at 62,417,860 bp
  • ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT, chromosome 4 at 87,841,267 bp
  • C to T, chromosome 4 at 96,001,270 bp
  • A to G, chromosome 5 at 86,182,309 bp
  • T to C, chromosome 5 at 115,554,062 bp
  • A to G, chromosome 5 at 122,242,668 bp
  • A to G, chromosome 5 at 135,987,336 bp
  • A to T, chromosome 6 at 30,554,194 bp
  • A to T, chromosome 6 at 66,637,515 bp
  • A to G, chromosome 8 at 14,831,465 bp
  • A to G, chromosome 8 at 61,054,333 bp
  • C to T, chromosome 8 at 125,891,112 bp
  • G to T, chromosome 9 at 70,002,111 bp
  • C to A, chromosome 10 at 51,725,490 bp
  • A to G, chromosome 10 at 69,270,316 bp
  • A to T, chromosome 10 at 77,870,509 bp
  • A to G, chromosome 10 at 127,248,254 bp
  • G to A, chromosome 11 at 75,495,426 bp
  • A to T, chromosome 11 at 95,763,790 bp
  • T to A, chromosome 11 at 97,806,896 bp
  • C to A, chromosome 11 at 102,361,222 bp
  • A to T, chromosome 12 at 101,937,406 bp
  • G to T, chromosome 12 at 111,543,608 bp
  • G to A, chromosome 15 at 31,276,816 bp
  • A to G, chromosome 16 at 31,885,076 bp
  • T to C, chromosome 16 at 44,492,361 bp
  • T to G, chromosome 16 at 45,965,107 bp
  • A to T, chromosome 17 at 29,135,780 bp
  • T to C, chromosome 18 at 57,730,780 bp
  • T to C, chromosome 19 at 36,615,538 bp
  • T to C, chromosome 19 at 60,580,367 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6629 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044751-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.