Strain Name:
C57BL/6J-MtgxR6670Btlr/Mmmh
Stock Number:
044790-MU
Citation ID:
RRID:MMRRC_044790-MU
Other Names:
R6670 (G1)
Major Collection:

Strain Information

Sod2
Name: superoxide dismutase 2, mitochondrial
Synonyms: MnSOD, manganese SOD, manganese superoxide dismutase, Sod-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20656
VEGA: 17
Homologene: 530
Sema6d
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms: 1110067B02Rik, Sema6D-6, Sema6D-5, Sema6D-4, Sema6D-2, Sema6D-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214968
Homologene: 16195
Tnf
Name: tumor necrosis factor
Synonyms: TNF-alpha, tumor necrosis factor-alpha, TNF alpha, TNFalpha, DIF, Tnfsf1a, Tnfa
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21926
Homologene: 496
Ccdc12
Name: coiled-coil domain containing 12
Synonyms: 2700094L05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72654
Homologene: 41751
Slc1a6
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Polk
Name: polymerase (DNA directed), kappa
Synonyms: Dinb1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27015
VEGA: 13
HGNC: HGNC:9183
Homologene: 32140
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Tbc1d23
Name: TBC1 domain family, member 23
Synonyms: 4930451A13Rik, D030022P07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67581
VEGA: 16
Homologene: 10126
Tank
Name: TRAF family member-associated Nf-kappa B activator
Synonyms: I-TRAF, E430026L09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21353
Homologene: 3081
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99480
Homologene: 124162
Ctsl
Name: cathepsin L
Synonyms: major excreted protein, MEP, Cat L, 1190035F06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13039
VEGA: 13
Homologene: 76699
Cul1
Name: cullin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26965
HGNC: HGNC:2551
Homologene: 2663
Trmt2a
Name: TRM2 tRNA methyltransferase 2A
Synonyms: Htf9c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15547
Homologene: 7374
Fbxw9
Name: F-box and WD-40 domain protein 9
Synonyms: 1110017H11Rik, Fbw9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68628
Homologene: 23598
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Fbxw16
Name: F-box and WD-40 domain protein 16
Synonyms: 7420402K12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320083
Homologene: 110776
Vmn2r75
Name: vomeronasal 2, receptor 75
Synonyms: EG546981
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546981
Homologene: 115466
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Bcl9l
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80288
VEGA: 9
Homologene: 65615
Brd8dc
Name: BRD8 domain containing
Synonyms: 4933408B17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 271508
Samd5
Name: sterile alpha motif domain containing 5
Synonyms: E130306M17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320825
Homologene: 37106
Hrnr
Name: hornerin
Synonyms: 1110033K19Rik, A530063N20Rik, S100a18
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68723
Homologene: 138092
AW551984
Name: expressed sequence AW551984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244810
HGNC: HGNC:6658
Abcc2
Name: ATP-binding cassette, sub-family member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Hhatl
Name: hedgehog acyltransferase-like
Synonyms: 1110011D13Rik, Gup1, Mitsugumin 56, Mg56
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74770
VEGA: 9
Homologene: 19287
Acsm3
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sa, Sah
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20216
Homologene: 74559
Rab3gap1
Name: RAB3 GTPase activating protein subunit 1
Synonyms: 1700003B17Rik, 4732493F09Rik, p130
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226407
Homologene: 45617
Grap
Name: GRB2-related adaptor protein
Synonyms: 8430435N19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71520
Homologene: 4822
Wnt2
Name: wingless-type MMTV integration site family, member 2
Synonyms: Wnt-2, Irp, Int1l1, m-irp, Mirp, 2610510E18Rik, Wnt2a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22413
Homologene: 20719
Oxgr1
Name: oxoglutarate (alpha-ketoglutarate) receptor 1
Synonyms: LOC239283, Gpr99, P2Y15, Gpr80, Cysltr3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239283
VEGA: 14
HGNC: HGNC:4531
Homologene: 25878
Ighv1-62-1
Name: immunoglobulin heavy variable 1-62-1
Synonyms: Gm9232
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668544
Krtap16-3
Name: keratin associated protein 16-3
Synonyms: 5430404J20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71369
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 127,930,775 bp
  • T to C, chromosome 2 at 61,644,424 bp
  • A to G, chromosome 2 at 76,725,711 bp
  • A to G, chromosome 2 at 120,924,130 bp
  • GTGATAC to G, chromosome 2 at 124,654,842 bp
  • A to T, chromosome 3 at 93,331,885 bp
  • T to A, chromosome 3 at 122,276,221 bp
  • A to G, chromosome 4 at 43,255,562 bp
  • C to A, chromosome 6 at 18,028,092 bp
  • T to A, chromosome 6 at 47,517,134 bp
  • T to A, chromosome 7 at 86,148,436 bp
  • T to A, chromosome 7 at 119,780,755 bp
  • T to A, chromosome 8 at 85,062,210 bp
  • T to C, chromosome 9 at 39,592,996 bp
  • GTGAACATGAACATGAACATGAAC to GTGAACATGAACATGAACATGAACATGAAC, chromosome 9 at 44,507,072 bp
  • C to T, chromosome 9 at 60,872,024 bp
  • T to A, chromosome 9 at 109,438,212 bp
  • T to G, chromosome 9 at 110,708,527 bp
  • T to C, chromosome 9 at 121,789,071 bp
  • A to T, chromosome 10 at 9,629,064 bp
  • C to A, chromosome 10 at 78,787,812 bp
  • A to G, chromosome 11 at 61,660,238 bp
  • T to C, chromosome 12 at 115,386,909 bp
  • T to C, chromosome 13 at 64,364,102 bp
  • A to G, chromosome 13 at 83,662,597 bp
  • G to A, chromosome 13 at 96,496,630 bp
  • A to T, chromosome 14 at 120,022,257 bp
  • A to G, chromosome 14 at 123,464,672 bp
  • C to T, chromosome 16 at 18,250,477 bp
  • A to T, chromosome 16 at 57,214,217 bp
  • A to T, chromosome 16 at 88,962,652 bp
  • T to A, chromosome 17 at 13,008,365 bp
  • A to C, chromosome 17 at 35,201,824 bp
  • A to G, chromosome 17 at 81,649,454 bp
  • A to G, chromosome 18 at 34,586,266 bp
  • A to G, chromosome 19 at 43,839,411 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6670 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044790-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.