Strain Name:
C57BL/6J-MtgxR6791Btlr/Mmmh
Stock Number:
044904-MU
Citation ID:
RRID:MMRRC_044904-MU
Other Names:
R6791 (G1)
Major Collection:

Strain Information

Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Pax2
Name: paired box 2
Synonyms: Pax-2, Opdc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18504
HGNC: HGNC:8616
Homologene: 2968
Bet1l
Name: Bet1 golgi vesicular membrane trafficking protein like
Synonyms: 2610021K23Rik, golgi SNARE, Gs15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54399
Homologene: 10293
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
Homologene: 1746
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Mllt6
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms: Af17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246198
HGNC: HGNC:7138
Homologene: 31347
Fbxl20
Name: F-box and leucine-rich repeat protein 20
Synonyms: C86145, Fbl2, 2610511F20Rik, 4632423N09Rik, Scr, Scrapper
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72194
Homologene: 68784
Cog3
Name: component of oligomeric golgi complex 3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338337
VEGA: 14
Homologene: 5854
Prss16
Name: serine protease 16 (thymus)
Synonyms: TSSP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54373
HGNC: HGNC:9480
Homologene: 38106
Polg
Name: polymerase (DNA directed), gamma
Synonyms: Pol gamma, polymerase gamma, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, Polga
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18975
HGNC: HGNC:9179
Homologene: 2016
Mtmr2
Name: myotubularin related protein 2
Synonyms: 6030445P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77116
HGNC: HGNC:7450
Homologene: 22951
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Zfp74
Name: zinc finger protein 74
Synonyms: Zfp66, KRAB8, 2810054M15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72723
Homologene: 51861
Ddhd2
Name: DDHD domain containing 2
Synonyms: SAMWD1, 2010305K11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72108
Homologene: 66646
Heatr6
Name: HEAT repeat containing 6
Synonyms: 2700008B19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217026
Homologene: 11116
Sh3bp5l
Name: SH3 binding domain protein 5 like
Synonyms: 2310074E09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 79566
Homologene: 32584
Treml2
Name: triggering receptor expressed on myeloid cells-like 2
Synonyms: LOC328833
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328833
VEGA: 17
Homologene: 81906
Skor1
Name: SKI family transcriptional corepressor 1
Synonyms: C230094B15Rik, Corl1, Lbxcor1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 207667
Homologene: 18175
Atp12a
Name: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Synonyms: cHKA, Atp1al1, HKalpha2, ATPase H+K+-transporting, alpha 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192113
VEGA: 14
Homologene: 68197
Grm6
Name: glutamate receptor, metabotropic 6
Synonyms: mGluR6, nerg1, nob3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108072
HGNC: HGNC:4598
Homologene: 20232
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Smad6
Name: SMAD family member 6
Synonyms: Smad 6, Madh6, b2b390Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17130
HGNC: HGNC:6772
Homologene: 4079
Vmn2r6
Name: vomeronasal 2, receptor 6
Synonyms: EG620718, EG667069
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667069
Homologene: 129754
Cfap206
Name: cilia and flagella associated protein 206
Synonyms: 1700003M02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69329
Homologene: 18713
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Nadsyn1
Name: NAD synthetase 1
Synonyms: 9130012B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78914
Homologene: 6098
Xpc
Name: xeroderma pigmentosum, complementation group C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22591
Homologene: 3401
Ppargc1b
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 beta
Synonyms: PGC-1beta/ERRL1, 4631412G21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 170826
Homologene: 15776
Klk7
Name: kallikrein related-peptidase 7 (chymotryptic, stratum corneum)
Synonyms: Prss6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23993
HGNC: HGNC:6368
Homologene: 37998
Ctrb1
Name: chymotrypsinogen B1
Synonyms: Prt-2, 2200008D09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66473
Homologene: 88564
Rspo1
Name: R-spondin 1
Synonyms: R-spondin, Rspondin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192199
Homologene: 52148
Naalad2
Name: N-acetylated alpha-linked acidic dipeptidase 2
Synonyms: NAALADASE2, NAADALASE2, D9Ertd285e, GCPIII, GCP3, Folh1b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72560
Homologene: 3294
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Ugt2b1
Name: UDP glucuronosyltransferase 2 family, polypeptide B1
Synonyms: 1300012D20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71773
Homologene: 68144
AW551984
Name: expressed sequence AW551984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244810
HGNC: HGNC:6658
Spart
Name: spartin
Synonyms: TAHCCP1, Spg20
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229285
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210789
Homologene: 45451
Ngp
Name: neutrophilic granule protein
Synonyms: clone B6, myeloid granule protein, bectenecin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18054
Homologene: 49180
Fdps
Name: farnesyl diphosphate synthetase
Synonyms: Fdpsl1, 6030492I17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110196
HGNC: HGNC:3631
Homologene: 1519
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Mgst1
Name: microsomal glutathione S-transferase 1
Synonyms: 1500002K10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56615
HGNC: HGNC:7061
Homologene: 10544
Prss54
Name: serine protease 54
Synonyms: 4931432M23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70993
Homologene: 19278
Orm2
Name: orosomucoid 2
Synonyms: Orm-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18406
Homologene: 130632
Or6c5c
Name: olfactory receptor family 6 subfamily C member 5C
Synonyms: GA_x6K02T2PULF-11141498-11142436, MOR111-10, Olfr787
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258069
Homologene: 105326
Or5af1
Name: olfactory receptor family 5 subfamily AF member 1
Synonyms: GA_x6K02T2NKPP-575829-574903, MOR222-4P, Olfr312
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258065
Homologene: 77375
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: PGR20, Gpr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435529
Homologene: 45213
Gm8369
Name: predicted gene 8369
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 666926
Zfp131
Name: zinc finger protein 131
Synonyms: 2610109I01Rik, Znf131
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72465
VEGA: 13
Homologene: 12464
Alyreffm5
Name: Aly/REF export factor family member 5
Synonyms: Gm4302
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100043227
VEGA: 10
Homologene: 130068
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 93,066,137 bp
  • T to C, chromosome 1 at 193,334,861 bp
  • T to C, chromosome 2 at 122,093,443 bp
  • G to A, chromosome 3 at 55,127,561 bp
  • T to C, chromosome 3 at 64,538,159 bp
  • A to G, chromosome 3 at 89,095,352 bp
  • T to C, chromosome 4 at 34,711,414 bp
  • C to T, chromosome 4 at 47,300,518 bp
  • A to T, chromosome 4 at 63,363,959 bp
  • A to G, chromosome 4 at 125,007,183 bp
  • T to A, chromosome 4 at 143,895,682 bp
  • TGCCGCCGCCGCCGCCACCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC, chromosome 5 at 23,499,476 bp
  • C to A, chromosome 5 at 86,919,257 bp
  • G to A, chromosome 6 at 91,506,857 bp
  • G to A, chromosome 6 at 138,141,807 bp
  • A to G, chromosome 7 at 29,934,435 bp
  • A to G, chromosome 7 at 43,813,260 bp
  • A to G, chromosome 7 at 79,460,109 bp
  • A to G, chromosome 7 at 140,854,505 bp
  • A to T, chromosome 7 at 143,819,108 bp
  • T to C, chromosome 8 at 25,752,215 bp
  • T to G, chromosome 8 at 95,564,655 bp
  • A to G, chromosome 8 at 111,689,349 bp
  • T to C, chromosome 9 at 13,805,382 bp
  • T to C, chromosome 9 at 18,385,130 bp
  • T to G, chromosome 9 at 39,600,659 bp
  • T to C, chromosome 9 at 63,140,354 bp
  • A to G, chromosome 9 at 64,012,227 bp
  • A to C, chromosome 9 at 110,419,949 bp
  • TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA to TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA, chromosome 10 at 100,341,499 bp
  • G to A, chromosome 10 at 129,463,154 bp
  • T to A, chromosome 11 at 9,378,504 bp
  • T to C, chromosome 11 at 50,859,774 bp
  • C to A, chromosome 11 at 58,346,272 bp
  • T to C, chromosome 11 at 58,832,077 bp
  • T to A, chromosome 11 at 69,908,510 bp
  • T to C, chromosome 11 at 83,758,341 bp
  • T to C, chromosome 11 at 97,680,602 bp
  • T to C, chromosome 11 at 98,109,510 bp
  • A to T, chromosome 13 at 22,006,067 bp
  • T to C, chromosome 13 at 100,154,960 bp
  • A to G, chromosome 13 at 119,766,593 bp
  • G to A, chromosome 14 at 56,386,982 bp
  • A to G, chromosome 14 at 75,730,678 bp
  • T to G, chromosome 14 at 101,608,259 bp
  • T to C, chromosome 17 at 42,710,883 bp
  • A to G, chromosome 17 at 48,309,219 bp
  • C to A, chromosome 18 at 61,307,676 bp
  • C to T, chromosome 19 at 3,600,753 bp
  • T to A, chromosome 19 at 11,511,836 bp
  • A to T, chromosome 19 at 44,788,821 bp
  • A to T, chromosome Y at 1,325,042 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6791 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044904-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.