Strain Name:
C57BL/6J-MtgxR6906Btlr/Mmmh
Stock Number:
044998-MU
Citation ID:
RRID:MMRRC_044998-MU
Other Names:
R6906 (G1)
Major Collection:

Strain Information

Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20349
Homologene: 8247
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Lypd1
Name: Ly6/Plaur domain containing 1
Synonyms: C530008O16Rik, 2700050C12Rik, Lynx2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72585
Homologene: 16937
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
Homologene: 1746
Aplf
Name: aprataxin and PNKP like factor
Synonyms: 2010301N04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72103
Homologene: 49753
Sfpq
Name: splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms: D4Ertd314e, 9030402K04Rik, 2810416M14Rik, 5730453G22Rik, 1110004P21Rik, REP1, PSF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71514
Homologene: 3714
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Ascc1
Name: activating signal cointegrator 1 complex subunit 1
Synonyms: ASC1p50, CGI-18, 1810015P09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69090
VEGA: 10
Homologene: 41079
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Hsf1
Name: heat shock factor 1
Synonyms: heat shock transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15499
VEGA: 15
HGNC: HGNC:5224
Homologene: 74556
Nup85
Name: nucleoporin 85
Synonyms: frount, Pcnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 445007
HGNC: HGNC:8734
Homologene: 11755
Fhip1b
Name: FHF complex subunit HOOK interacting protein 1B
Synonyms: 4632419K20Rik, 6530415H11Rik, Fam160a2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74349
Homologene: 75329
Anp32a
Name: acidic nuclear phosphoprotein 32 family member A
Synonyms: pp32, Anp32
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11737
Homologene: 137229
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Tpd52l1
Name: tumor protein D52-like 1
Synonyms: D53
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21987
VEGA: 10
Homologene: 2468
Abcf2
Name: ATP-binding cassette, sub-family F member 2
Synonyms: 0710005O05Rik, Drr3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27407
Homologene: 21408
Tcaim
Name: T cell activation inhibitor, mitochondrial
Synonyms: LOC382117, D9Ertd402e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382117
Homologene: 45481
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Rnf112
Name: ring finger protein 112
Synonyms: bfp, Zfp179, neurolastin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22671
Homologene: 5176
Or8h7
Name: olfactory receptor family 8 subfamily H member 7
Synonyms: GA_x6K02T2Q125-48376288-48375341, MOR206-2, Olfr1097
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258840
Homologene: 37005
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Zcchc4
Name: zinc finger, CCHC domain containing 4
Synonyms: 4930449I23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78796
Homologene: 14632
Trmt1l
Name: tRNA methyltransferase 1 like
Synonyms: Trm1-like, 1190005F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98685
Homologene: 12801
Kansl1l
Name: KAT8 regulatory NSL complex subunit 1-like
Synonyms: C430010P07Rik, 1110028C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68691
Homologene: 27376
Hycc1
Name: hyccin PI4KA lipid kinase complex subunit 1
Synonyms: hyccin, Fam126a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 84652
Homologene: 57175
Dmrta1
Name: doublesex and mab-3 related transcription factor like family A1
Synonyms: Dmrt4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242523
Homologene: 18477
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: Obph1, ORP5, 1110006M06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79196
Homologene: 98024
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Vmn1r171
Name: vomeronasal 1 receptor 171
Synonyms: V3R7, V1rd7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81012
Homologene: 128341
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Ehd3
Name: EH-domain containing 3
Synonyms: Ehd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57440
HGNC: HGNC:3244
Homologene: 81837
Shc3
Name: src homology 2 domain-containing transforming protein C3
Synonyms: ShcC, N-Shc, Rai
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20418
VEGA: 13
Homologene: 7536
Prl8a2
Name: prolactin family 8, subfamily a, member 2
Synonyms: D/tPRP, DPRP, mdPRP, Dtprp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13529
Homologene: 49230
Sesn3
Name: sestrin 3
Synonyms: SEST3, 5630400E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75747
Homologene: 14386
Arl6ip4
Name: ADP-ribosylation factor-like 6 interacting protein 4
Synonyms: Aip-4, Srp25
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 65105
Homologene: 9606
Bin1
Name: bridging integrator 1
Synonyms: Amphl, Amphiphysin 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 30948
VEGA: 18
HGNC: HGNC:1052
Homologene: 113707
Tex19.1
Name: testis expressed gene 19.1
Synonyms: 2410081M02Rik, Tex19, Tex19.1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73679
Homologene: 75271
Crtap
Name: cartilage associated protein
Synonyms: CASP, 5730529N23Rik, Leprel3, P3h5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56693
HGNC: HGNC:2379
Homologene: 21280
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 44,056,013 bp
  • T to C, chromosome 1 at 66,723,278 bp
  • T to C, chromosome 1 at 125,910,459 bp
  • T to A, chromosome 1 at 139,423,390 bp
  • T to C, chromosome 1 at 151,452,175 bp
  • T to C, chromosome 2 at 86,890,747 bp
  • A to G, chromosome 3 at 72,919,485 bp
  • T to A, chromosome 3 at 105,986,873 bp
  • A to G, chromosome 4 at 89,691,966 bp
  • A to T, chromosome 4 at 118,269,277 bp
  • GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC to GCCGCCGCAGCAGCC, chromosome 4 at 127,021,626 bp
  • A to G, chromosome 5 at 14,240,587 bp
  • A to T, chromosome 5 at 23,999,958 bp
  • A to G, chromosome 5 at 24,568,842 bp
  • A to G, chromosome 5 at 52,823,634 bp
  • A to G, chromosome 5 at 124,116,551 bp
  • A to G, chromosome 6 at 40,747,919 bp
  • A to G, chromosome 6 at 87,630,086 bp
  • G to A, chromosome 7 at 23,632,379 bp
  • G to A, chromosome 7 at 105,388,269 bp
  • A to G, chromosome 7 at 141,698,733 bp
  • G to C, chromosome 7 at 143,694,328 bp
  • C to A, chromosome 8 at 128,935,681 bp
  • A to G, chromosome 9 at 14,325,641 bp
  • A to G, chromosome 9 at 62,377,569 bp
  • T to A, chromosome 9 at 114,381,632 bp
  • C to T, chromosome 9 at 122,834,774 bp
  • T to G, chromosome 10 at 31,332,954 bp
  • G to A, chromosome 10 at 33,233,948 bp
  • G to A, chromosome 10 at 60,004,852 bp
  • T to A, chromosome 11 at 59,032,918 bp
  • T to C, chromosome 11 at 61,450,389 bp
  • T to A, chromosome 11 at 115,580,943 bp
  • T to C, chromosome 11 at 121,147,122 bp
  • T to G, chromosome 12 at 75,995,986 bp
  • T to A, chromosome 12 at 112,785,313 bp
  • T to A, chromosome 13 at 27,348,917 bp
  • T to C, chromosome 13 at 51,466,559 bp
  • T to C, chromosome 15 at 47,847,173 bp
  • T to C, chromosome 15 at 76,477,719 bp
  • C to A, chromosome 16 at 4,633,304 bp
  • C to T, chromosome 17 at 23,820,363 bp
  • T to A, chromosome 17 at 58,395,307 bp
  • T to C, chromosome 17 at 73,830,338 bp
  • C to A, chromosome 18 at 32,421,925 bp
  • A to C, chromosome 18 at 58,071,819 bp
  • A to T, chromosome 19 at 3,622,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6906 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044998-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.