Strain Name:
C57BL/6J-MtgxR6916Btlr/Mmmh
Stock Number:
045037-MU
Citation ID:
RRID:MMRRC_045037-MU
Other Names:
R6916 (G1)
Major Collection:

Strain Information

Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Ints3
Name: integrator complex subunit 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229543
Homologene: 11309
Flnb
Name: filamin, beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 286940
HGNC: HGNC:3755
Homologene: 37480
Fbxl20
Name: F-box and leucine-rich repeat protein 20
Synonyms: C86145, Fbl2, 2610511F20Rik, 4632423N09Rik, Scr, Scrapper
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72194
Homologene: 68784
Kifbp
Name: kinesin family binding protein
Synonyms: 2510003E04Rik, Kif1bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72320
Homologene: 9223
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Ctnnd1
Name: catenin delta 1
Synonyms: P120, Ctnnd, p120-catenin, Catns, catenin (cadherin associated protein), delta 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12388
HGNC: HGNC:2515
Homologene: 1017
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Acin1
Name: apoptotic chromatin condensation inducer 1
Synonyms: 2610510L13Rik, 2610036I19Rik, Acinus
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56215
Homologene: 22853
Atp6v1c1
Name: ATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms: 1700025B18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66335
VEGA: 15
HGNC: HGNC:856
Homologene: 1281
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Cnr1
Name: cannabinoid receptor 1
Synonyms: CB1, CB1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12801
HGNC: HGNC:2159
Homologene: 7273
Efna1
Name: ephrin A1
Synonyms: B61, Epl1, EFL-1, LERK-1, Lerk1, Eplg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13636
HGNC: HGNC:3221
Homologene: 3262
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: NMHC II-C, 2400004E04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71960
Homologene: 23480
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Olfm4
Name: olfactomedin 4
Synonyms: LOC239192, LOC380924, GC1, OlfD, GW112, pPD4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380924
VEGA: 14
Homologene: 4684
Ddx20
Name: DEAD box helicase 20
Synonyms: GEMIN3, dp103, DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53975
HGNC: HGNC:2743
Homologene: 5214
Rsrc1
Name: arginine/serine-rich coiled-coil 1
Synonyms: SRrp53, 1200013F24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66880
Homologene: 41147
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Rrbp1
Name: ribosome binding protein 1
Synonyms: mRRp0, ES/130, p180, mRRp1.8, mRRp2, mRRp5.4, mRRp10, mRRp16.8, mRRp15b, mRRp15a, mRRp41, mRRp47, 1700087N07Rik, 5730465C04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 81910
Homologene: 68138
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Sh2d3c
Name: SH2 domain containing 3C
Synonyms: Shep1, SH2-containing Eph receptor-binding protein 1, Cas/HEF1-associated signal transducer, Chat, Nsp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27387
Homologene: 69145
Vtcn1
Name: V-set domain containing T cell activation inhibitor 1
Synonyms: B7-H4, B7x
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242122
Homologene: 11627
Wdr19
Name: WD repeat domain 19
Synonyms: C330027H04Rik, D330023L08Rik, Ift144, DYF2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213081
Homologene: 11842
Wdr72
Name: WD repeat domain 72
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546144
Homologene: 52326
Ciita
Name: class II transactivator
Synonyms: C2ta, Gm9475
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12265
VEGA: 16
HGNC: HGNC:7067
Homologene: 207
Nell1
Name: NEL-like 1
Synonyms: B230343H07Rik, l7R6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Pcdhb11
Name: protocadherin beta 11
Synonyms: Pcdhb5E, PcdhbK
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93882
HGNC: HGNC:8690
Homologene: 62178
Tmem202
Name: transmembrane protein 202
Synonyms: 4930425N13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73893
VEGA: 9
Homologene: 52264
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Irak3
Name: interleukin-1 receptor-associated kinase 3
Synonyms: IRAK-M, 4833428C18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73914
Homologene: 36215
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 112417
Homologene: 137225
Lrrc10
Name: leucine rich repeat containing 10
Synonyms: D330003I11Rik, Hrlrrp, Serdin1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237560
VEGA: 10
Homologene: 17154
Or1e29
Name: olfactory receptor family 1 subfamily E member 29
Synonyms: GA_x6K02T2P1NL-3932085-3931147, MOR135-6, Olfr389
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259011
Homologene: 85925
Aoc1l2
Name: amine oxidase copper containing 1-like 2
Synonyms: 1600015I10Rik, Doxl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69761
HGNC: HGNC:80
Homologene: 79726
Abcg3
Name: ATP binding cassette subfamily G member 3
Synonyms: Mxr2, Abcp2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27405
HGNC: HGNC:74
Homologene: 86845
Fam149a
Name: family with sequence similarity 149, member A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212326
Homologene: 27540
Hps1
Name: HPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms: 6030422N11Rik, Hermansky-Pudlak syndrome 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 192236
HGNC: HGNC:5163
Homologene: 163
Cenpb
Name: centromere protein B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12616
HGNC: HGNC:1852
Homologene: 1370
Asb10
Name: ankyrin repeat and SOCS box-containing 10
Synonyms: Asb-10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117590
Homologene: 135975
Klrb1f
Name: killer cell lectin-like receptor subfamily B member 1F
Synonyms: Nkrp1f, A630024B12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232408
HGNC: HGNC:6373
Homologene: 135762
Necab2
Name: N-terminal EF-hand calcium binding protein 2
Synonyms: Necab2, Efcbp2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 117148
Homologene: 62200
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Bdkrb2
Name: bradykinin receptor, beta 2
Synonyms: B2, B(2), kinin B2, BK2R, B2R
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12062
VEGA: 12
HGNC: HGNC:1030
Homologene: 519
Krt79
Name: keratin 79
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223917
Homologene: 89169
Cep112
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76380
Homologene: 44915
Lrp11
Name: low density lipoprotein receptor-related protein 11
Synonyms: 9830160H19Rik, 1700034J19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237253
Homologene: 13133
Or10d1c
Name: olfactory receptor family 10 subfamily D member 1C
Synonyms: GA_x6K02T2PVTD-32678895-32677963, MOR224-6, Olfr934
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258434
VEGA: 9
Homologene: 51730
Tlcd4
Name: TLC domain containing 4
Synonyms: C730036B01Rik, 4930577M16Rik, Tmem56
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99887
Homologene: 45107
Errfi1
Name: ERBB receptor feedback inhibitor 1
Synonyms: 1300002F13Rik, Mig-6, RALT
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74155
Homologene: 10344
Dnaaf3
Name: dynein, axonemal assembly factor 3
Synonyms: 6030429G01Rik, b2b1739Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436022
Homologene: 16205
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: WIP, D2Ertd120e, Waspip
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215280
Homologene: 86891
Gm5862
Name: predicted gene 5862
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545739
Homologene: 69402
Or2h2b-ps1
Name: olfactory receptor family 2 subfamily H member 2B, pseudogene 1
Synonyms: GA_x6K02T2PSCP-1611898-1610960, MOR256-38, Olfr753-ps1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258052
Ftl1
Name: ferritin light polypeptide 1
Synonyms: Ftl, L-ferritin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14325
HGNC: HGNC:3999
Homologene: 79330
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,910,025 bp
  • C to T, chromosome 2 at 32,752,653 bp
  • A to T, chromosome 2 at 35,010,032 bp
  • A to T, chromosome 2 at 59,968,776 bp
  • C to A, chromosome 2 at 73,437,404 bp
  • A to T, chromosome 2 at 84,609,646 bp
  • A to C, chromosome 2 at 131,179,624 bp
  • A to T, chromosome 2 at 143,974,598 bp
  • T to C, chromosome 3 at 53,547,688 bp
  • C to T, chromosome 3 at 66,994,649 bp
  • A to G, chromosome 3 at 86,084,911 bp
  • T to C, chromosome 3 at 89,276,388 bp
  • T to C, chromosome 3 at 90,406,334 bp
  • G to T, chromosome 3 at 100,888,163 bp
  • T to C, chromosome 3 at 105,680,613 bp
  • T to C, chromosome 3 at 121,207,156 bp
  • A to G, chromosome 4 at 33,943,897 bp
  • T to C, chromosome 4 at 137,638,233 bp
  • A to T, chromosome 4 at 150,867,473 bp
  • T to C, chromosome 5 at 24,537,856 bp
  • G to T, chromosome 5 at 26,019,348 bp
  • G to A, chromosome 5 at 65,225,334 bp
  • T to A, chromosome 5 at 87,254,600 bp
  • T to A, chromosome 5 at 104,974,735 bp
  • T to A, chromosome 6 at 48,931,053 bp
  • A to T, chromosome 6 at 129,053,811 bp
  • T to A, chromosome 7 at 4,527,533 bp
  • T to C, chromosome 7 at 44,629,313 bp
  • T to C, chromosome 7 at 45,459,540 bp
  • T to C, chromosome 7 at 50,701,179 bp
  • A to T, chromosome 7 at 141,864,717 bp
  • C to A, chromosome 8 at 45,350,406 bp
  • G to T, chromosome 8 at 119,467,616 bp
  • T to C, chromosome 9 at 38,982,904 bp
  • C to A, chromosome 9 at 59,525,474 bp
  • A to G, chromosome 9 at 74,155,039 bp
  • A to G, chromosome 9 at 110,626,108 bp
  • T to C, chromosome 10 at 5,227,912 bp
  • C to A, chromosome 10 at 7,608,714 bp
  • T to C, chromosome 10 at 33,157,018 bp
  • T to C, chromosome 10 at 62,566,064 bp
  • C to A, chromosome 10 at 117,045,549 bp
  • A to T, chromosome 10 at 120,201,365 bp
  • G to A, chromosome 11 at 23,458,023 bp
  • T to A, chromosome 11 at 73,777,069 bp
  • T to A, chromosome 11 at 98,113,253 bp
  • C to A, chromosome 11 at 108,859,376 bp
  • T to A, chromosome 11 at 120,273,009 bp
  • T to A, chromosome 12 at 71,164,544 bp
  • C to T, chromosome 12 at 105,591,779 bp
  • C to T, chromosome 14 at 7,907,171 bp
  • A to T, chromosome 14 at 30,095,364 bp
  • A to T, chromosome 14 at 54,665,416 bp
  • T to A, chromosome 14 at 80,014,198 bp
  • T to C, chromosome 15 at 38,677,581 bp
  • C to T, chromosome 15 at 101,936,170 bp
  • T to A, chromosome 16 at 10,509,207 bp
  • T to A, chromosome 16 at 91,654,785 bp
  • T to C, chromosome 17 at 37,169,973 bp
  • G to A, chromosome 18 at 5,114,682 bp
  • A to T, chromosome 18 at 37,422,381 bp
  • ATCCTCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 19 at 42,766,725 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6916 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045037-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.