Strain Name:
C57BL/6J-MtgxR7079Btlr/Mmmh
Stock Number:
045173-MU
Citation ID:
RRID:MMRRC_045173-MU
Other Names:
R7079 (G1)
Major Collection:

Strain Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Cort
Name: cortistatin
Synonyms: PCST, CST
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12854
HGNC: HGNC:2257
Homologene: 997
Gfpt2
Name: glutamine fructose-6-phosphate transaminase 2
Synonyms: GFAT2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14584
HGNC: HGNC:4242
Homologene: 68439
Trmt13
Name: tRNA methyltransferase 13
Synonyms: A930028L21Rik, 4631408H19Rik, Ccdc76
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229780
Homologene: 6875
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: Sac1p, SAC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Trim23
Name: tripartite motif-containing 23
Synonyms: Arfd1, 6330516O20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 81003
HGNC: HGNC:660
Homologene: 1251
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, Nirf, D130071B19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Zfp35
Name: zinc finger protein 35
Synonyms: Zfp-35
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22694
Homologene: 133081
Wwc2
Name: WW, C2 and coiled-coil domain containing 2
Synonyms: D8Ertd594e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52357
Homologene: 32618
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Hey2
Name: hairy/enhancer-of-split related with YRPW motif 2
Synonyms: CHF1, Hrt2, Herp1, Hesr2, bHLHb32
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15214
HGNC: HGNC:4881
Homologene: 22705
Atp2b1
Name: ATPase, Ca++ transporting, plasma membrane 1
Synonyms: PMCA1, E130111D10Rik, 2810442I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67972
VEGA: 10
HGNC: HGNC:814
Homologene: 55597
Aspn
Name: asporin
Synonyms: 4631401G09Rik, SLRR1C, PLAP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66695
VEGA: 13
Homologene: 32357
Tyw3
Name: tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Synonyms: 5230400J09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209584
Homologene: 44531
Zscan21
Name: zinc finger and SCAN domain containing 21
Synonyms: CTfin51, RU49, Zfp-38, Zfp38, Zipro1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22697
Homologene: 56530
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTP-BL, Ptpri, PTPL1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Egfem1
Name: EGF-like and EMI domain containing 1
Synonyms: 6130401L20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75740
Homologene: 135950
Wdr93
Name: WD repeat domain 93
Synonyms: EG626359
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 626359
Homologene: 56878
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Slc26a6
Name: solute carrier family 26, member 6
Synonyms: CFEX, Pat1, B930010B04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 171429
Homologene: 99903
Cyp1a2
Name: cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms: P450-3, CP12, aromatic compound inducible
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13077
VEGA: 9
HGNC: HGNC:2596
Homologene: 68082
Mmd
Name: monocyte to macrophage differentiation-associated
Synonyms: 1200017E07Rik, 1810073C06Rik, Paqr11
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67468
HGNC: HGNC:7153
Homologene: 8204
Caskin1
Name: CASK interacting protein 1
Synonyms: C630036E02Rik, 3300002N10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268932
VEGA: 17
Homologene: 25873
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231014
Homologene: 27396
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279029
Homologene: 19586
Psme2b
Name: protease (prosome, macropain) activator subunit 2B
Synonyms: Psme2-like, PA28b2, Psme2b, Psme2b-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 621823
HGNC: HGNC:9569
Fbxw21
Name: F-box and WD-40 domain protein 21
Synonyms: E330009P21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320082
Homologene: 110776
Cadps2
Name: Ca2+-dependent activator protein for secretion 2
Synonyms: cpd2, A230044C21Rik, Caps2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320405
Homologene: 23060
2210408I21Rik
Name: RIKEN cDNA 2210408I21 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72371
Homologene: 89234
Lmln
Name: leishmanolysin-like (metallopeptidase M8 family)
Synonyms: 5330415H22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239833
Homologene: 13198
Kctd11
Name: potassium channel tetramerisation domain containing 11
Synonyms: Ren
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216858
Homologene: 17697
Spata31f1a
Name: spermatogenesis associated 31 subfamily F member 1A
Synonyms: Gm12429, Fam205a1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433698
Homologene: 79022
4921509C19Rik
Name: RIKEN cDNA 4921509C19 gene
Synonyms: LOC381389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381393
Homologene: 72396
Fbln5
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23876
VEGA: 12
HGNC: HGNC:3602
Homologene: 38170
Pfkm
Name: phosphofructokinase, muscle
Synonyms: Pfk-4, Pfk4, PFK-M, PFK-A, Pfkx
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18642
VEGA: 15
HGNC: HGNC:8877
Homologene: 20101
Hhat
Name: hedgehog acyltransferase
Synonyms: Skn, 2810432O22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226861
Homologene: 41232
Or52ab7
Name: olfactory receptor family 52 subfamily AB member 7
Synonyms: GA_x6K02T2PBJ9-6037823-6038782, MOR23-4P, MOR23-5, Olfr598
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257975
Homologene: 132401
Itpripl2
Name: inositol 1,4,5-triphosphate receptor interacting protein-like 2
Synonyms: E030018N11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319622
Homologene: 45882
Or1l4
Name: olfactory receptor family 1 subfamily L member 4
Synonyms: GA_x6K02T2NLDC-33885305-33886243, MOR138-1, Olfr365
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258656
Homologene: 74156
Ubqln3
Name: ubiquilin 3
Synonyms: 4933400K24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244178
Homologene: 9700
Or4c101
Name: olfactory receptor family 4 subfamily C member 101
Synonyms: GA_x6K02T2Q125-50046879-50047784, MOR238-2, Olfr1188
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258921
Reep5
Name: receptor accessory protein 5
Synonyms: DP1/TB2, TB2/DP1, Dp1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13476
VEGA: 18
Homologene: 68479
Lrrc30
Name: leucine rich repeat containing 30
Synonyms: LOC240131
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240131
VEGA: 17
Homologene: 33184
Gm10837
Name: predicted gene 10837
Type: Gene
Species: Mouse
Chromosome: 14
BC035947
Name: cDNA sequence BC035947
Type: Gene
Species: Mouse
Chromosome: 1
2310009B15Rik
Name: RIKEN cDNA 2310009B15 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69549
Homologene: 19923
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 78,497,915 bp
  • T to A, chromosome 1 at 138,852,127 bp
  • T to C, chromosome 1 at 192,553,046 bp
  • A to G, chromosome 2 at 26,949,347 bp
  • C to A, chromosome 2 at 37,202,173 bp
  • C to A, chromosome 2 at 88,559,509 bp
  • T to G, chromosome 2 at 151,473,278 bp
  • T to A, chromosome 3 at 29,153,582 bp
  • T to C, chromosome 3 at 116,582,831 bp
  • G to C, chromosome 3 at 154,593,789 bp
  • T to C, chromosome 4 at 42,851,718 bp
  • C to G, chromosome 4 at 149,127,391 bp
  • A to G, chromosome 5 at 9,399,253 bp
  • T to C, chromosome 5 at 103,501,886 bp
  • C to T, chromosome 5 at 138,126,466 bp
  • A to G, chromosome 6 at 23,323,409 bp
  • T to C, chromosome 7 at 79,749,292 bp
  • C to T, chromosome 7 at 103,329,184 bp
  • A to T, chromosome 7 at 104,141,371 bp
  • A to G, chromosome 7 at 118,490,869 bp
  • G to A, chromosome 8 at 47,847,545 bp
  • T to C, chromosome 9 at 57,681,878 bp
  • T to A, chromosome 9 at 108,857,948 bp
  • A to G, chromosome 9 at 109,145,510 bp
  • T to A, chromosome 9 at 123,569,997 bp
  • T to C, chromosome 10 at 11,079,958 bp
  • T to A, chromosome 10 at 30,834,386 bp
  • A to G, chromosome 10 at 74,317,125 bp
  • A to G, chromosome 10 at 99,018,733 bp
  • G to A, chromosome 10 at 109,767,292 bp
  • A to G, chromosome 11 at 48,945,616 bp
  • G to A, chromosome 11 at 49,837,751 bp
  • A to G, chromosome 11 at 69,880,021 bp
  • T to A, chromosome 11 at 90,267,499 bp
  • G to A, chromosome 12 at 51,787,855 bp
  • G to A, chromosome 12 at 101,757,408 bp
  • A to G, chromosome 13 at 49,566,555 bp
  • T to C, chromosome 13 at 77,254,204 bp
  • A to T, chromosome 13 at 104,187,293 bp
  • C to G, chromosome 14 at 122,490,730 bp
  • G to A, chromosome 15 at 73,221,809 bp
  • G to A, chromosome 15 at 98,095,082 bp
  • T to C, chromosome 16 at 33,067,291 bp
  • CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG to CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG, chromosome 16 at 91,656,841 bp
  • T to C, chromosome 17 at 24,498,884 bp
  • T to C, chromosome 17 at 67,632,021 bp
  • C to T, chromosome 18 at 24,003,300 bp
  • G to A, chromosome 18 at 34,347,123 bp
  • T to G, chromosome 19 at 30,082,790 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7079 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045173-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.