Strain Name:
C57BL/6J-MtgxR7169Btlr/Mmmh
Stock Number:
045229-MU
Citation ID:
RRID:MMRRC_045229-MU
Other Names:
R7169 (G1)
Major Collection:

Strain Information

Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Icos
Name: inducible T cell co-stimulator
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54167
HGNC: HGNC:5351
Homologene: 8097
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Csnk2a2
Name: casein kinase 2, alpha prime polypeptide
Synonyms: CK2, 1110035J23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13000
HGNC: HGNC:2459
Homologene: 20444
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Ilf3
Name: interleukin enhancer binding factor 3
Synonyms: NF90
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16201
VEGA: 9
HGNC: HGNC:6038
Homologene: 7785
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pk-3, Pk-2, Pk3, Pkm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Cog6
Name: component of oligomeric golgi complex 6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67542
Homologene: 10802
Ppp1r10
Name: protein phosphatase 1, regulatory subunit 10
Synonyms: 2610025H06Rik, D17Ertd808e, PNUTS
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52040
HGNC: HGNC:9284
Homologene: 2033
Trim66
Name: tripartite motif-containing 66
Synonyms: D7H11orf29, Tif1d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330627
Homologene: 28044
Ahi1
Name: Abelson helper integration site 1
Synonyms: Ahi-1, 1700015F03Rik, D10Bwg0629e, Jouberin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Lmbr1l
Name: limb region 1 like
Synonyms: 1110013E13Rik, D15Ertd735e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74775
Homologene: 10011
Thap1
Name: THAP domain containing, apoptosis associated protein 1
Synonyms: 4833431A01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73754
Homologene: 10005
Lratd1
Name: LRAT domain containing 1
Synonyms: 4731402F03Rik, 2310003N02Rik, Fam84a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 105005
VEGA: 12
Homologene: 12576
Angptl6
Name: angiopoietin-like 6
Synonyms: Arp5, AGF, Angiopoietin-related growth factor, 6330404E11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70726
Homologene: 88931
Enpp5
Name: ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms: D17Abb1e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83965
Homologene: 23313
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Zdhhc5
Name: zinc finger, DHHC domain containing 5
Synonyms: Zisp, 1110032A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228136
Homologene: 9147
Tlr3
Name: toll-like receptor 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142980
Homologene: 20696
Skor2
Name: SKI family transcriptional corepressor 2
Synonyms: Fussel18, Corl2, Gm7348
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 664805
VEGA: 18
Homologene: 64797
Rorc
Name: RAR-related orphan receptor gamma
Synonyms: thymus orphan receptor, Thor, RORgamma
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19885
Homologene: 21051
Mroh7
Name: maestro heat-like repeat family member 7
Synonyms: LOC381538, Gm1027, Heatr8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381538
Homologene: 19633
Dennd6b
Name: DENN domain containing 6B
Synonyms: 1700027J05Rik, Fam116b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69440
VEGA: 15
Homologene: 57065
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Nuak1
Name: NUAK family, SNF1-like kinase, 1
Synonyms: B230104P22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77976
Homologene: 8896
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Mybpc3
Name: myosin binding protein C, cardiac
Synonyms: cardiac C-protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17868
HGNC: HGNC:7551
Homologene: 215
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Hipk1
Name: homeodomain interacting protein kinase 1
Synonyms: Myak, 1110062K04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15257
Homologene: 56483
Setmar
Name: SET domain without mariner transposase fusion
Synonyms: 5830404F24Rik, Etet2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74729
Homologene: 68519
Arhgef11
Name: Rho guanine nucleotide exchange factor 11
Synonyms: PDZ-RhoGEF, Prg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213498
Homologene: 11409
Or4k37
Name: olfactory receptor family 4 subfamily K member 37
Synonyms: GA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P, Olfr1281
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257979
Homologene: 73992
Gsdme
Name: gasdermin E
Synonyms: 4932441K13Rik, 2310037D07Rik, Fin15, Dfna5h, Dfna5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54722
HGNC: HGNC:2810
Homologene: 3242
Eml3
Name: echinoderm microtubule associated protein like 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225898
VEGA: 19
Homologene: 27044
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 3110063L10Rik, 2810478N18Rik, OTTMUSG00000021748, ENSMUSG00000040612, Dbsm1, D1Ertd471e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Pop5
Name: processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae)
Synonyms: 1500019J17Rik, Rnasep3, 2700077E03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117109
Homologene: 41076
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Cyria
Name: CYFIP related Rac1 interactor A
Synonyms: 2410157M17Rik, D12Ertd553e, Fam49a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76820
VEGA: 12
Homologene: 12657
Snx14
Name: sorting nexin 14
Synonyms: YR-14, C330035N22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244962
Homologene: 17823
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Ntn5
Name: netrin 5
Synonyms: LOC243967
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243967
Homologene: 17106
Dpm1
Name: dolichyl-phosphate mannosyltransferase subunit 1, catalytic
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13480
HGNC: HGNC:3005
Homologene: 2865
Etnppl
Name: ethanolamine phosphate phospholyase
Synonyms: 1300019H02Rik, Agxt2l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71760
Homologene: 69440
Oprk1
Name: opioid receptor, kappa 1
Synonyms: KOR-1, R21, Oprk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18387
HGNC: HGNC:8154
Homologene: 20253
Ctif
Name: CBP80/20-dependent translation initiation factor
Synonyms: LOC269037, Gm672
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269037
VEGA: 18
Homologene: 56682
Lrrc25
Name: leucine rich repeat containing 25
Synonyms: Mapa
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211228
Homologene: 51663
Tnfrsf11a
Name: tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Synonyms: Rank, TRANCE-R
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21934
Homologene: 2848
Rabggta
Name: Rab geranylgeranyl transferase, a subunit
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56187
VEGA: 14
HGNC: HGNC:9795
Homologene: 32443
Eya4
Name: EYA transcriptional coactivator and phosphatase 4
Synonyms: B130023L16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14051
VEGA: 10
HGNC: HGNC:3522
Homologene: 3025
Clic3
Name: chloride intracellular channel 3
Synonyms: 2300003G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69454
HGNC: HGNC:2064
Homologene: 3432
Or4f14
Name: olfactory receptor family 4 subfamily F member 14
Synonyms: GA_x6K02T2Q125-72954873-72953935, MOR245-15, Olfr1306
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258023
Homologene: 128383
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: TS14, Adamts-14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Il1r1
Name: interleukin 1 receptor, type I
Synonyms: IL-1 receptor alpha chain, CD121a, Il1r-1, IL-iR, IL-1R1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16177
HGNC: HGNC:5993
Homologene: 677
Brsk1
Name: BR serine/threonine kinase 1
Synonyms: LOC381979, SAD-B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381979
Homologene: 57169
Snph
Name: syntaphilin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241727
Homologene: 8817
Or13a1
Name: olfactory receptor family 13 subfamily A member 1
Synonyms: GA_x54KRFPKN04-58127726-58128655, MOR253-9, Olfr211
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258914
Homologene: 17434
Meltf
Name: melanotransferrin
Synonyms: MTf, CD228, melanotransferrin, Mfi2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30060
VEGA: 16
HGNC: HGNC:7037
Homologene: 4335
Zfp663
Name: zinc finger protein 663
Synonyms: LOC381405, Gm1008
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381405
Homologene: 128277
Calhm5
Name: calcium homeostasis modulator family member 5
Synonyms: Fam26e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103511
VEGA: 10
Homologene: 17807
Or56a41
Name: olfactory receptor family 56 subfamily A member 41, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-7720330-7719479, MOR40-10P, Olfr680
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257981
Gm12886
Name: predicted gene 12886
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666921
Homologene: 111034
Ly6c1
Name: lymphocyte antigen 6 family member C1
Synonyms: Ly-6C, Ly6c
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17067
Homologene: 113718
Igkv5-43
Name: immunoglobulin kappa chain variable 5-43
Synonyms: Igk-V23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381783
Pof1b
Name: premature ovarian failure 1B
Synonyms: 2310066B14Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 69693
Homologene: 11785
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
BC024063
Name: cDNA sequence BC024063
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 666584
VEGA: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 5,589,081 bp
  • T to C, chromosome 1 at 40,293,359 bp
  • A to G, chromosome 1 at 60,995,546 bp
  • G to A, chromosome 1 at 104,947,353 bp
  • A to T, chromosome 1 at 105,844,695 bp
  • G to A, chromosome 1 at 166,307,934 bp
  • G to T, chromosome 1 at 181,702,365 bp
  • G to A, chromosome 2 at 25,458,719 bp
  • A to T, chromosome 2 at 84,702,331 bp
  • T to C, chromosome 2 at 91,118,179 bp
  • T to A, chromosome 2 at 111,328,598 bp
  • A to G, chromosome 2 at 111,912,594 bp
  • T to A, chromosome 2 at 151,594,387 bp
  • C to T, chromosome 2 at 165,352,439 bp
  • A to T, chromosome 2 at 168,211,423 bp
  • G to T, chromosome 3 at 52,989,966 bp
  • A to G, chromosome 3 at 87,727,448 bp
  • A to G, chromosome 3 at 87,808,594 bp
  • A to T, chromosome 3 at 94,389,180 bp
  • C to T, chromosome 3 at 103,744,217 bp
  • A to T, chromosome 3 at 130,620,696 bp
  • T to A, chromosome 4 at 106,691,639 bp
  • T to G, chromosome 4 at 121,416,751 bp
  • T to A, chromosome 5 at 115,240,228 bp
  • T to C, chromosome 6 at 50,227,378 bp
  • T to A, chromosome 6 at 69,823,535 bp
  • A to T, chromosome 6 at 73,038,746 bp
  • T to C, chromosome 6 at 107,567,604 bp
  • C to A, chromosome 6 at 108,065,088 bp
  • G to T, chromosome 6 at 116,494,064 bp
  • T to C, chromosome 7 at 4,715,404 bp
  • C to T, chromosome 7 at 45,686,774 bp
  • G to A, chromosome 7 at 85,858,455 bp
  • T to C, chromosome 7 at 105,091,190 bp
  • A to G, chromosome 7 at 109,455,121 bp
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp
  • A to T, chromosome 8 at 45,397,019 bp
  • T to G, chromosome 8 at 70,617,787 bp
  • A to G, chromosome 8 at 95,488,378 bp
  • T to A, chromosome 8 at 108,951,398 bp
  • T to A, chromosome 8 at 117,040,835 bp
  • T to A, chromosome 9 at 20,875,179 bp
  • T to A, chromosome 9 at 21,395,426 bp
  • A to G, chromosome 9 at 59,671,625 bp
  • A to G, chromosome 9 at 88,398,309 bp
  • T to G, chromosome 10 at 21,055,019 bp
  • A to T, chromosome 10 at 23,155,947 bp
  • T to A, chromosome 10 at 34,092,164 bp
  • A to G, chromosome 10 at 61,204,928 bp
  • T to C, chromosome 10 at 82,110,459 bp
  • T to C, chromosome 10 at 84,374,745 bp
  • A to G, chromosome 12 at 12,359,232 bp
  • A to G, chromosome 12 at 14,150,618 bp
  • G to A, chromosome 13 at 73,784,560 bp
  • C to G, chromosome 14 at 55,720,901 bp
  • A to G, chromosome 14 at 103,260,200 bp
  • C to A, chromosome 15 at 75,044,646 bp
  • C to A, chromosome 15 at 76,105,914 bp
  • A to T, chromosome 15 at 89,188,852 bp
  • CACTACATACTACATACTACATACTACATACTACATACTACATAC to CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC, chromosome 15 at 98,909,158 bp
  • ACTACAT to ACTACATGCTACAT, chromosome 15 at 98,909,194 bp
  • A to G, chromosome 16 at 31,880,162 bp
  • T to C, chromosome 17 at 35,929,473 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • T to C, chromosome 18 at 75,472,016 bp
  • T to A, chromosome 18 at 76,860,986 bp
  • A to G, chromosome 19 at 8,933,464 bp
  • G to A, chromosome 19 at 27,244,328 bp
  • A to G, chromosome X at 112,644,345 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7169 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045229-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.