Strain Name:
C57BL/6J-MtgxR7189Btlr/Mmmh
Stock Number:
045238-MU
Citation ID:
RRID:MMRRC_045238-MU
Other Names:
R7189 (G1)
Major Collection:

Strain Information

Chrna7
Name: cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms: Acra7, alpha7, alpha7 nicotinic receptor, alpha7-nAChR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11441
Homologene: 593
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Zbtb43
Name: zinc finger and BTB domain containing 43
Synonyms: 1700010E06Rik, Zfp297b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71834
Homologene: 8514
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Parvb
Name: parvin, beta
Synonyms: D15Gsk1, affixin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170736
Homologene: 8342
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Stim2
Name: stromal interaction molecule 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116873
Homologene: 32490
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Hsph1
Name: heat shock 105kDa/110kDa protein 1
Synonyms: hsp-E7I, HSP110, Hsp105, hsp110/105
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15505
Homologene: 21322
Kdm8
Name: lysine (K)-specific demethylase 8
Synonyms: 3110005O21Rik, Jmjd5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77035
Homologene: 49791
Cntn2
Name: contactin 2
Synonyms: Tax, TAG-1, axonin, D130012K04Rik, TAG1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21367
HGNC: HGNC:2172
Homologene: 3720
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Lepr
Name: leptin receptor
Synonyms: Obr, leptin receptor gene-related protein, OB-RGRP, LEPROT, obl, obese-like, Modb1, Leprb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Hrh2
Name: histamine receptor H2
Synonyms: H2r
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15466
HGNC: HGNC:5183
Homologene: 40613
Gask1b
Name: golgi associated kinase 1B
Synonyms: 2210419I08Rik, Ened, 1110032E23Rik, Fam198b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68659
Homologene: 9590
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Dnpep
Name: aspartyl aminopeptidase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13437
HGNC: HGNC:2981
Homologene: 6110
Plxna2
Name: plexin A2
Synonyms: OCT, Plxn2, 2810428A13Rik, PlexA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Mgl2
Name: macrophage galactose N-acetyl-galactosamine specific lectin 2
Synonyms: CD301b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216864
Homologene: 7836
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Fgf10
Name: fibroblast growth factor 10
Synonyms: FGF-10, AEY17, Gsfaey17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14165
HGNC: HGNC:3666
Homologene: 3284
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: LOC381663, A330009G12Rik, Sec63d1, Mer3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330149
Homologene: 87103
Vipr1
Name: vasoactive intestinal peptide receptor 1
Synonyms: VIP-R1, VPAC1, VIP receptor subtype 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22354
Homologene: 3399
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Atosa
Name: atos homolog A
Synonyms: 6330415I01Rik, C130047D21Rik, BC031353, Fam214a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235493
VEGA: 9
Homologene: 35065
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Chrnd
Name: cholinergic receptor, nicotinic, delta polypeptide
Synonyms: Achr-4, Acrd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11447
HGNC: HGNC:1965
Homologene: 37340
Kif2b
Name: kinesin family member 2B
Synonyms: 1700063D03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73470
Homologene: 23775
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244114
Homologene: 115466
Pkn1
Name: protein kinase N1
Synonyms: Pkn, PRK1, PAK1, Stk3, Prkcl1, F730027O18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320795
HGNC: HGNC:9405
Homologene: 48130
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Abtb2
Name: ankyrin repeat and BTB domain containing 2
Synonyms: BPOZ-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99382
Homologene: 15904
Sh2d2a
Name: SH2 domain containing 2A
Synonyms: TSAd, Lck-associated adapter protein, Lad, RIBP, Rlk/Itk-binding protein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27371
Homologene: 2958
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Ssrp1
Name: structure specific recognition protein 1
Synonyms: T160, Hmgi-rs3, Hmg1-rs1, Hmgox
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20833
Homologene: 110735
Or4k47
Name: olfactory receptor family 4 subfamily K member 47
Synonyms: GA_x6K02T2Q125-72673494-72672556, MOR248-4, Olfr1297
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258890
Homologene: 115545
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, 2900056N03Rik, E030045D18Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Or52n3
Name: olfactory receptor family 52 subfamily N member 3
Synonyms: GA_x6K02T2PBJ9-7509539-7510489, MOR34-7, Olfr665
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258810
Homologene: 110477
Mfsd4a
Name: major facilitator superfamily domain containing 4A
Synonyms: A930031D07Rik, Mfsd4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213006
Homologene: 45419
Cyp3a25
Name: cytochrome P450, family 3, subfamily a, polypeptide 25
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56388
Homologene: 135775
Efcab3
Name: EF-hand calcium binding domain 3
Synonyms: 4921510J17Rik, Efcab13, Efcab15, Gm11639, Gm11639
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108167860
Homologene: 18304
Tigd3
Name: tigger transposable element derived 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 332359
VEGA: 19
Homologene: 129795
Zbtb24
Name: zinc finger and BTB domain containing 24
Synonyms: ZNF450
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268294
VEGA: 10
Homologene: 8870
Vmn1r75
Name: vomeronasal 1 receptor 75
Synonyms: V1rg6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171241
Homologene: 44234
Fam161b
Name: family with sequence similarity 161, member B
Synonyms: 9830169C18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217705
Homologene: 17581
Otud3
Name: OTU domain containing 3
Synonyms: 3110030K17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73162
Homologene: 66103
Bmp4
Name: bone morphogenetic protein 4
Synonyms: Bmp2b, Bmp2b1, Bmp2b-1, Bmp-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12159
HGNC: HGNC:1071
Homologene: 7247
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4930516C23Rik, 4921509E07Rik, Fam71d
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70897
Homologene: 49887
Elk4
Name: ELK4, member of ETS oncogene family
Synonyms: Sap1, A130026I01Rik, 2310011G17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13714
HGNC: HGNC:3326
Homologene: 1492
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Gm49355
Name: predicted gene, 49355
Type: Gene
Species: Mouse
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 45,333,657 bp
  • G to C, chromosome 1 at 46,242,142 bp
  • T to C, chromosome 1 at 75,313,430 bp
  • C to T, chromosome 1 at 87,191,058 bp
  • A to G, chromosome 1 at 132,019,389 bp
  • A to T, chromosome 1 at 132,052,393 bp
  • A to G, chromosome 1 at 132,517,086 bp
  • G to T, chromosome 1 at 194,801,058 bp
  • A to G, chromosome 2 at 33,462,295 bp
  • A to G, chromosome 2 at 82,993,237 bp
  • G to A, chromosome 2 at 85,045,562 bp
  • G to T, chromosome 2 at 103,567,516 bp
  • T to A, chromosome 2 at 111,621,193 bp
  • A to T, chromosome 3 at 68,617,699 bp
  • G to T, chromosome 3 at 68,617,700 bp
  • T to A, chromosome 3 at 79,886,807 bp
  • T to A, chromosome 3 at 87,848,361 bp
  • T to C, chromosome 4 at 101,814,764 bp
  • T to C, chromosome 4 at 120,132,219 bp
  • T to C, chromosome 4 at 137,533,561 bp
  • C to T, chromosome 4 at 138,909,554 bp
  • C to A, chromosome 5 at 14,521,918 bp
  • T to A, chromosome 5 at 54,116,128 bp
  • T to A, chromosome 5 at 94,537,751 bp
  • A to G, chromosome 5 at 106,901,703 bp
  • A to T, chromosome 5 at 146,003,060 bp
  • T to C, chromosome 5 at 149,630,460 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • T to A, chromosome 7 at 11,880,548 bp
  • T to C, chromosome 7 at 63,106,027 bp
  • T to G, chromosome 7 at 85,754,917 bp
  • A to T, chromosome 7 at 104,881,141 bp
  • A to T, chromosome 7 at 125,460,931 bp
  • C to A, chromosome 7 at 141,861,061 bp
  • A to T, chromosome 8 at 83,692,673 bp
  • T to C, chromosome 9 at 75,004,351 bp
  • G to T, chromosome 9 at 95,862,791 bp
  • T to A, chromosome 9 at 101,126,422 bp
  • C to A, chromosome 9 at 121,664,554 bp
  • C to A, chromosome 10 at 5,424,295 bp
  • G to A, chromosome 10 at 38,965,733 bp
  • G to A, chromosome 10 at 41,464,476 bp
  • C to A, chromosome 10 at 92,937,728 bp
  • G to T, chromosome 11 at 70,137,043 bp
  • C to G, chromosome 11 at 91,577,137 bp
  • T to C, chromosome 11 at 105,095,864 bp
  • G to T, chromosome 12 at 17,373,561 bp
  • C to T, chromosome 12 at 78,712,208 bp
  • T to C, chromosome 12 at 84,348,646 bp
  • A to T, chromosome 13 at 11,883,123 bp
  • A to G, chromosome 13 at 54,221,251 bp
  • A to G, chromosome 13 at 118,789,123 bp
  • T to A, chromosome 14 at 12,296,672 bp
  • A to G, chromosome 14 at 46,383,999 bp
  • T to C, chromosome 15 at 84,303,471 bp
  • C to A, chromosome 16 at 72,960,151 bp
  • A to G, chromosome 17 at 52,894,117 bp
  • C to T, chromosome 18 at 15,062,643 bp
  • A to G, chromosome 19 at 5,893,022 bp
  • A to T, chromosome 19 at 38,760,137 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7189 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045238-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.