Strain Name:
C57BL/6J-MtgxR7374Btlr/Mmmh
Stock Number:
045457-MU
Citation ID:
RRID:MMRRC_045457-MU
Other Names:
R7374 (G1)
Major Collection:

Strain Information

Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Mtbp
Name: Mdm2, transformed 3T3 cell double minute p53 binding protein
Synonyms: MDM2BP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105837
HGNC: HGNC:7417
Homologene: 11102
Rfx5
Name: regulatory factor X, 5 (influences HLA class II expression)
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53970
HGNC: HGNC:9986
Ckap2l
Name: cytoskeleton associated protein 2-like
Synonyms: 2010016H04Rik, 2610318C08Rik, Radmis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70466
Homologene: 51866
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Gfpt1
Name: glutamine fructose-6-phosphate transaminase 1
Synonyms: GFAT, GFA, GFAT1, 2810423A18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14583
HGNC: HGNC:4241
Homologene: 68220
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Sv2a
Name: synaptic vesicle glycoprotein 2a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64051
Homologene: 32237
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: CD140b, Pdgfr
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Trim33
Name: tripartite motif-containing 33
Synonyms: Tif1g, 8030451N04Rik, ectodermin, Ecto
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Kdm5d
Name: lysine demethylase 5D
Synonyms: Smcy, Jarid1d, HY
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 20592
Homologene: 55838
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Gas6
Name: growth arrest specific 6
Synonyms: growth arrest-specific, GAS 6, Gas-6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14456
HGNC: HGNC:4168
Homologene: 638
Vmn1r59
Name: vomeronasal 1 receptor 59
Synonyms: V1rd10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404284
Homologene: 41799
Uroc1
Name: urocanase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243537
Homologene: 76629
Rhbdl2
Name: rhomboid like 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230726
Homologene: 49508
Fbxo44
Name: F-box protein 44
Synonyms: Fbx6a, FBX30, FBG3, Fbxo6a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230903
Homologene: 13232
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Slc15a2
Name: solute carrier family 15 (H+/peptide transporter), member 2
Synonyms: Pept2, 8430408C16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57738
Homologene: 56912
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR1, GluR-A, Glr-1, Glur-1, Glur1, GluRA, Glr1, 2900051M01Rik, HIPA1, GluA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Abcd4
Name: ATP-binding cassette, sub-family D member 4
Synonyms: P69r, Pxmp1l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19300
VEGA: 12
HGNC: HGNC:68
Homologene: 3703
Vmn2r74
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546980
Homologene: 115466
Nrxn1
Name: neurexin I
Synonyms: alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, neurexin I alpha, neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I alpha, 1700062G21Rik, A230068P09Rik, 9330127H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57764
Homologene: 10934
Vmn1r52
Name: vomeronasal 1 receptor 52
Synonyms: VN3, V1ra7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113849
Vmn2r68
Name: vomeronasal 2, receptor 68
Synonyms: EG620697, Vmn2r68-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620697
Homologene: 115466
Or5p68
Name: olfactory receptor family 5 subfamily P member 68
Synonyms: GA_x6K02T2PBJ9-10676998-10676054, MOR204-35, Olfr493
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258307
Homologene: 17188
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Slc9a9
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms: 5730527A11Rik, Nhe9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331004
Homologene: 69753
Radil
Name: Ras association and DIL domains
Synonyms: D930005D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231858
Homologene: 77648
Or8k25
Name: olfactory receptor family 8 subfamily K member 25
Synonyms: GA_x6K02T2Q125-47883395-47882454, MOR188-1, MOR188-1, MOR188-9, MOR188-7, Olfr1515, Olfr1061
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259022
Homologene: 79468
Prps1l1
Name: phosphoribosyl pyrophosphate synthetase 1-like 1
Synonyms: 1700011K15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75456
HGNC: HGNC:9463
Homologene: 75282
Sv2c
Name: synaptic vesicle glycoprotein 2c
Synonyms: 4930527L09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75209
Homologene: 57152
Cyp2c68
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433247
Homologene: 74936
Nyap1
Name: neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms: Nyap1, 6430598A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243300
Homologene: 18320
Tmem181a
Name: transmembrane protein 181A
Synonyms: 5930418K15Rik, Gpr178, C76977, Tmem181
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77106
Homologene: 44787
Ddx51
Name: DEAD box helicase 51
Synonyms: 2310061O04Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69663
Homologene: 6850
Ffar2
Name: free fatty acid receptor 2
Synonyms: Gpr43
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233079
HGNC: HGNC:4501
Homologene: 133911
Myl2
Name: myosin, light polypeptide 2, regulatory, cardiac, slow
Synonyms: MLC-2v, MLC-2, Mlc2v, Mylpc, Gm32672
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17906
HGNC: HGNC:7583
Homologene: 55462
Trav9d-4
Name: T cell receptor alpha variable 9D-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 667574
Gm3371
Name: predicted gene 3371
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100861814
Gm8257
Name: predicted pseudogene 8257
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666725
Pom121l12
Name: POM121 membrane glycoprotein-like 12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432536
Homologene: 136280
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 2 at 86,413,852 bp
  • T to C, chromosome 2 at 129,284,963 bp
  • T to C, chromosome 3 at 80,741,076 bp
  • C to T, chromosome 3 at 94,958,742 bp
  • A to T, chromosome 3 at 96,188,209 bp
  • T to A, chromosome 3 at 103,310,323 bp
  • A to G, chromosome 4 at 118,257,492 bp
  • G to C, chromosome 4 at 123,817,865 bp
  • T to A, chromosome 4 at 148,156,637 bp
  • C to A, chromosome 5 at 110,657,132 bp
  • A to G, chromosome 5 at 122,101,663 bp
  • C to T, chromosome 5 at 137,735,529 bp
  • G to A, chromosome 5 at 142,485,480 bp
  • G to A, chromosome 6 at 40,757,439 bp
  • A to G, chromosome 6 at 87,050,977 bp
  • A to T, chromosome 6 at 90,179,136 bp
  • T to C, chromosome 6 at 90,338,833 bp
  • T to C, chromosome 7 at 5,454,161 bp
  • T to C, chromosome 7 at 30,820,040 bp
  • A to T, chromosome 7 at 85,232,399 bp
  • T to C, chromosome 7 at 85,957,422 bp
  • T to C, chromosome 7 at 102,009,128 bp
  • A to G, chromosome 7 at 108,346,888 bp
  • A to T, chromosome 7 at 141,863,126 bp
  • A to T, chromosome 8 at 13,474,802 bp
  • A to C, chromosome 8 at 33,268,911 bp
  • A to G, chromosome 9 at 95,055,489 bp
  • G to A, chromosome 10 at 60,317,900 bp
  • A to G, chromosome 10 at 93,682,572 bp
  • C to T, chromosome 11 at 9,292,136 bp
  • A to T, chromosome 11 at 14,599,962 bp
  • T to A, chromosome 11 at 57,189,808 bp
  • T to C, chromosome 12 at 34,985,425 bp
  • A to T, chromosome 12 at 84,606,243 bp
  • C to T, chromosome 12 at 84,830,175 bp
  • T to G, chromosome 13 at 23,706,047 bp
  • A to T, chromosome 13 at 95,989,136 bp
  • A to G, chromosome 14 at 44,403,783 bp
  • T to C, chromosome 14 at 44,650,283 bp
  • A to G, chromosome 14 at 52,983,843 bp
  • T to A, chromosome 15 at 8,247,247 bp
  • A to C, chromosome 15 at 55,562,959 bp
  • G to A, chromosome 15 at 82,095,908 bp
  • G to T, chromosome 16 at 36,751,845 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to A, chromosome 17 at 6,304,258 bp
  • A to G, chromosome 17 at 90,588,669 bp
  • G to A, chromosome 18 at 61,071,708 bp
  • T to C, chromosome 19 at 39,739,204 bp
  • T to C, chromosome Y at 941,491 bp
  • T to C, chromosome Y at 1,381,305 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7374 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045457-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.