Strain Name:
C57BL/6J-MtgxR7389Btlr/Mmmh
Stock Number:
045471-MU
Citation ID:
RRID:MMRRC_045471-MU
Other Names:
R7389 (G1)
Major Collection:

Strain Information

Hdgfl2
Name: HDGF like 2
Synonyms: HRP-2, Hdgfrp2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15193
VEGA: 17
Homologene: 7355
Matr3
Name: matrin 3
Synonyms: D030046F20Rik, 2810017I02Rik, 1110061A14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17184
HGNC: HGNC:6912
Homologene: 7830
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Traf3
Name: TNF receptor-associated factor 3
Synonyms: LAP1, CAP-1, CD40bp, CRAF1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22031
Homologene: 7981
Tmeff1
Name: transmembrane protein with EGF-like and two follistatin-like domains 1
Synonyms: tomoregulin-like, M7365
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230157
Homologene: 130458
Map2k3
Name: mitogen-activated protein kinase kinase 3
Synonyms: MKK3, MAP kinase kinase 3, Prkmk3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26397
HGNC: HGNC:6843
Homologene: 56430
Anxa11
Name: annexin A11
Synonyms: Anx11, A830099O17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11744
HGNC: HGNC:535
Homologene: 22759
Sptb
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20741
Homologene: 295
Fstl3
Name: follistatin-like 3
Synonyms: Flrg, E030038F23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83554
HGNC: HGNC:3973
Homologene: 4280
Ncoa2
Name: nuclear receptor coactivator 2
Synonyms: TIF2/GRIP-1, Grip1, D1Ertd433e, glucocorticoid receptor-interacting protein 1, TIF2, TIF-2, SRC-2, KAT13C, bHLHe75
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17978
HGNC: HGNC:7669
Homologene: 4768
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50767
Homologene: 21333
Cntrl
Name: centriolin
Synonyms: IB3/5, 6720467O09Rik, Ma2a8, Cep1, b2b1468Clo, Cep110
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Ino80
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68142
Homologene: 75070
Trim11
Name: tripartite motif-containing 11
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94091
Homologene: 14225
Pja2
Name: praja ring finger ubiquitin ligase 2
Synonyms: Neurodap1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224938
Homologene: 32233
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Ssh1
Name: slingshot protein phosphatase 1
Synonyms: mSSH-1L, LOC384311
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231637
Homologene: 41299
Tspan18
Name: tetraspanin 18
Synonyms: 2610042G18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241556
Homologene: 24122
Tnip2
Name: TNFAIP3 interacting protein 2
Synonyms: ABIN-2, 1810020H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231130
Homologene: 11515
Usf3
Name: upstream transcription factor family member 3
Synonyms: LOC207806, LOC385650, 5530400K22Rik, Gm608
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207806
Homologene: 19504
Slc7a2
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
Synonyms: Tea, Atrc2, Cat2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11988
Homologene: 20659
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Vmn1r213
Name: vomeronasal 1 receptor 213
Synonyms: V1rh6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171249
Homologene: 110880
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57775
Homologene: 49641
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Asns
Name: asparagine synthetase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27053
HGNC: HGNC:753
Homologene: 69113
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Mybpc2
Name: myosin binding protein C, fast-type
Synonyms: Fast-type C-protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233199
HGNC: HGNC:7550
Homologene: 3331
Cyp2c50
Name: cytochrome P450, family 2, subfamily c, polypeptide 50
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107141
Homologene: 137231
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Paqr8
Name: progestin and adipoQ receptor family member VIII
Synonyms: 3110001D06Rik, 1700019B16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74229
Homologene: 32702
Rhbdl3
Name: rhomboid like 3
Synonyms: Ventrhoid, Vrho, Rhbdl4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246104
Homologene: 34700
Or5b21
Name: olfactory receptor family 5 subfamily B member 21
Synonyms: GA_x6K02T2RE5P-3191201-3192160, MOR202-4, Olfr1444
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258697
Homologene: 64906
Or5v1b
Name: olfactory receptor family 5 subfamily V member 1B
Synonyms: GA_x6K02T2PSCP-1989071-1990024, MOR249-1P, Olfr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545205
Homologene: 73968
Scart1
Name: scavenger receptor family member expressed on T cells 1
Synonyms: E430002D04Rik, Cd163l1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244233
Homologene: 129778
Krt15
Name: keratin 15
Synonyms: K15, Krt1-15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16665
HGNC: HGNC:6421
Homologene: 1712
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93838
Homologene: 14143
Lrriq3
Name: leucine-rich repeats and IQ motif containing 3
Synonyms: 4930438B07Rik, 4930511J15Rik, 4933403H06Rik, Lrrc44
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74435
Homologene: 23668
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320718
Homologene: 14179
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Tinf2
Name: Terf1 (TRF1)-interacting nuclear factor 2
Synonyms: TIN2, D14Wsu146e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 28113
VEGA: 14
Homologene: 8264
Tex19.1
Name: testis expressed gene 19.1
Synonyms: 2410081M02Rik, Tex19, Tex19.1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73679
Homologene: 75271
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Pcdhgb4
Name: protocadherin gamma subfamily B, 4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93701
HGNC: HGNC:8711
Homologene: 74507
Fabp2
Name: fatty acid binding protein 2, intestinal
Synonyms: Fabpi, I-FABP, Fabpi
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14079
HGNC: HGNC:3556
Homologene: 107
Trav14d-3-dv8
Name: T cell receptor alpha variable 14D-3-DV8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 634322
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 13,186,825 bp
  • C to A, chromosome 1 at 20,935,165 bp
  • A to G, chromosome 1 at 131,769,248 bp
  • T to C, chromosome 1 at 135,967,047 bp
  • C to T, chromosome 2 at 20,785,093 bp
  • A to T, chromosome 2 at 35,127,517 bp
  • G to A, chromosome 2 at 82,988,796 bp
  • A to T, chromosome 2 at 93,209,927 bp
  • A to C, chromosome 2 at 119,442,529 bp
  • G to T, chromosome 3 at 122,895,365 bp
  • A to G, chromosome 3 at 155,188,104 bp
  • A to G, chromosome 4 at 48,617,097 bp
  • A to G, chromosome 4 at 108,693,318 bp
  • G to T, chromosome 5 at 34,513,801 bp
  • A to T, chromosome 5 at 113,958,831 bp
  • C to A, chromosome 6 at 7,689,291 bp
  • G to T, chromosome 6 at 83,064,794 bp
  • G to A, chromosome 7 at 6,963,458 bp
  • T to G, chromosome 7 at 44,505,604 bp
  • A to G, chromosome 7 at 140,228,791 bp
  • C to T, chromosome 8 at 3,543,981 bp
  • A to G, chromosome 8 at 40,912,515 bp
  • G to A, chromosome 10 at 79,780,031 bp
  • T to G, chromosome 11 at 23,345,200 bp
  • C to T, chromosome 11 at 58,990,655 bp
  • A to G, chromosome 11 at 59,036,400 bp
  • A to T, chromosome 11 at 60,932,036 bp
  • T to A, chromosome 11 at 80,346,839 bp
  • A to T, chromosome 11 at 100,135,560 bp
  • T to C, chromosome 11 at 121,147,160 bp
  • G to T, chromosome 12 at 76,624,229 bp
  • C to A, chromosome 12 at 111,237,753 bp
  • T to C, chromosome 13 at 23,012,386 bp
  • A to T, chromosome 13 at 46,700,987 bp
  • C to A, chromosome 14 at 25,872,888 bp
  • C to T, chromosome 14 at 31,147,239 bp
  • T to C, chromosome 14 at 53,078,871 bp
  • G to T, chromosome 14 at 55,680,710 bp
  • T to A, chromosome 16 at 5,106,713 bp
  • T to A, chromosome 16 at 44,217,941 bp
  • T to C, chromosome 16 at 63,772,984 bp
  • A to G, chromosome 17 at 37,530,657 bp
  • T to G, chromosome 17 at 56,099,389 bp
  • T to A, chromosome 17 at 64,297,727 bp
  • A to G, chromosome 18 at 35,584,585 bp
  • T to C, chromosome 18 at 37,722,363 bp
  • G to T, chromosome 19 at 12,862,617 bp
  • G to T, chromosome 19 at 40,090,663 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7389 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045471-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.