Strain Name:
C57BL/6J-MtgxR7558Btlr/Mmmh
Stock Number:
045625-MU
Citation ID:
RRID:MMRRC_045625-MU
Other Names:
R7558 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Lemd2
Name: LEM domain containing 2
Synonyms: Lem2, NET25
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224640
VEGA: 17
Homologene: 17136
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: protein phosphatase 2A subunit beta, 4633401M22Rik, B56beta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68925
Homologene: 32269
Hmmr
Name: hyaluronan mediated motility receptor (RHAMM)
Synonyms: CD168, Rhamm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15366
HGNC: HGNC:5012
Homologene: 8271
Pabpc4
Name: poly(A) binding protein, cytoplasmic 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230721
HGNC: HGNC:8557
Homologene: 37855
Sec16a
Name: SEC16 homolog A, endoplasmic reticulum export factor
Synonyms: C230052J16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227648
Homologene: 10533
Tmem87a
Name: transmembrane protein 87A
Synonyms: A930025J12Rik, Elkin1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211499
Homologene: 9165
Foxk2
Name: forkhead box K2
Synonyms: 5730434B08Rik, 1110054H05Rik, Ilf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68837
HGNC: HGNC:6036
Homologene: 18748
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Rasal2
Name: RAS protein activator like 2
Synonyms: A330066M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226525
HGNC: HGNC:9874
Homologene: 35217
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Malt1
Name: MALT1 paracaspase
Synonyms: D430033E09Rik, paracaspase, Pcasp1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240354
HGNC: HGNC:6819
Homologene: 4938
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Clvs2
Name: clavesin 2
Synonyms: A330019N05Rik, Rlbp1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215890
Homologene: 27894
Vax1
Name: ventral anterior homeobox 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22326
Homologene: 7593
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213262
Homologene: 10584
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Nyap2
Name: neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
Synonyms: Jr6, 9430031J16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241134
Homologene: 18239
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Slc22a26
Name: solute carrier family 22 (organic cation transporter), member 26
Synonyms: BC014805
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236149
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Ptk2b
Name: PTK2 protein tyrosine kinase 2 beta
Synonyms: CAKbeta, Raftk, calcium-dependent tyrosine kinase, related adhesion focal tyrosine kinase, cellular adhesion kinase beta, proline-rich tyrosine kinase 2, PYK2, E430023O05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19229
HGNC: HGNC:9612
Homologene: 23001
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Kctd11
Name: potassium channel tetramerisation domain containing 11
Synonyms: Ren
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216858
Homologene: 17697
Cactin
Name: cactin, spliceosome C complex subunit
Synonyms: 2510012J08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70312
VEGA: 10
Homologene: 69553
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215798
Homologene: 10724
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1, Pyk1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Fmod
Name: fibromodulin
Synonyms: SLRR2E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14264
HGNC: HGNC:3774
Homologene: 1530
H2-Q6
Name: histocompatibility 2, Q region locus 6
Synonyms: Qa6, Qa-6, H-2Q6, 0610037M15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110557
Homologene: 128352
Or52n4b
Name: olfactory receptor family 52 subfamily N member 4B
Synonyms: GA_x6K02T2PBJ9-10874315-10875286, MOR34-9, MOR34-8P, MOR34-12, MOR34-9, Olfr1548, Olfr503
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259143
Homologene: 121509
Zbtb7a
Name: zinc finger and BTB domain containing 7a
Synonyms: Lrf, 9030619K07Rik, 9130006G12Rik, FBI-1, Pokemon, Zbtb7, Leukemia/lymphoma Related Factor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16969
Homologene: 7820
Adh6b
Name: alcohol dehydrogenase 6B (class V)
Synonyms: Adh5b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100417514
HGNC: HGNC:255
Homologene: 139477
Lrrc8b
Name: leucine rich repeat containing 8 family, member B
Synonyms: R75581, 2210408K08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433926
Homologene: 9103
B3gnt9
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Synonyms: B3gnt9-ps
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97440
Homologene: 13250
Or5b3
Name: olfactory receptor family 5 subfamily B member 3
Synonyms: GA_x6K02T2RE5P-3743369-3744289, MOR202-11, Olfr1469
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258690
HGNC: HGNC:8324
Homologene: 133675
Marchf8
Name: membrane associated ring-CH-type finger 8
Synonyms: 1300017E09Rik, Mir, March8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71779
Homologene: 12412
Dbndd2
Name: dysbindin domain containing 2
Synonyms: 2900022J10Rik, 1110017A21Rik, D2Bwg0891e, NKIP, dysbindin (dystrobrevin binding protein 1) domain containing 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52840
Homologene: 12276
1700093K21Rik
Name: RIKEN cDNA 1700093K21 gene
Synonyms: b2b3025Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67358
Homologene: 49849
Igfbpl1
Name: insulin-like growth factor binding protein-like 1
Synonyms: 2810011G06Rik, IGFBP-like protein, 2810453O06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75426
Homologene: 10292
Gdi1
Name: GDP dissociation inhibitor 1
Synonyms: GDIA, Rab GDIalpha
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 14567
HGNC: HGNC:4226
Homologene: 37487
Fignl2
Name: fidgetin-like 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 668225
VEGA: 15
Homologene: 28523
Gm45140
Name: predicted gene 45140
Type: Gene
Species: Mouse
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 65,272,623 bp
  • A to T, chromosome 1 at 81,269,373 bp
  • A to G, chromosome 1 at 134,040,993 bp
  • A to T, chromosome 1 at 140,523,190 bp
  • G to A, chromosome 1 at 157,175,836 bp
  • A to G, chromosome 2 at 20,855,610 bp
  • A to T, chromosome 2 at 26,439,734 bp
  • T to C, chromosome 2 at 41,341,936 bp
  • A to T, chromosome 2 at 119,771,254 bp
  • A to G, chromosome 2 at 120,374,510 bp
  • A to T, chromosome 2 at 142,758,826 bp
  • T to C, chromosome 2 at 164,490,216 bp
  • C to T, chromosome 3 at 76,429,785 bp
  • T to A, chromosome 3 at 138,352,536 bp
  • G to T, chromosome 4 at 45,813,497 bp
  • T to G, chromosome 4 at 123,294,620 bp
  • T to G, chromosome 4 at 145,154,580 bp
  • G to T, chromosome 5 at 105,481,711 bp
  • G to A, chromosome 6 at 87,821,529 bp
  • T to C, chromosome 6 at 116,403,565 bp
  • G to T, chromosome 6 at 146,390,865 bp
  • C to A, chromosome 7 at 46,303,160 bp
  • C to G, chromosome 7 at 108,544,721 bp
  • T to C, chromosome 8 at 105,254,672 bp
  • C to A, chromosome 9 at 110,147,116 bp
  • A to T, chromosome 10 at 14,431,607 bp
  • A to T, chromosome 10 at 33,543,464 bp
  • A to G, chromosome 10 at 80,722,921 bp
  • A to G, chromosome 10 at 81,148,435 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • G to A, chromosome 10 at 127,248,079 bp
  • G to T, chromosome 11 at 23,516,285 bp
  • A to G, chromosome 11 at 40,733,329 bp
  • A to T, chromosome 11 at 69,879,590 bp
  • T to C, chromosome 11 at 121,288,058 bp
  • A to T, chromosome 12 at 75,464,992 bp
  • G to A, chromosome 13 at 11,799,825 bp
  • A to G, chromosome 13 at 38,168,766 bp
  • T to C, chromosome 14 at 66,154,179 bp
  • C to A, chromosome 14 at 123,486,385 bp
  • C to T, chromosome 15 at 8,225,367 bp
  • T to A, chromosome 15 at 27,831,394 bp
  • T to C, chromosome 15 at 101,054,383 bp
  • T to A, chromosome 16 at 20,738,554 bp
  • C to A, chromosome 16 at 32,680,085 bp
  • T to C, chromosome 16 at 79,003,414 bp
  • C to A, chromosome 17 at 27,204,163 bp
  • A to G, chromosome 17 at 35,425,619 bp
  • G to A, chromosome 18 at 20,594,234 bp
  • T to C, chromosome 18 at 65,462,834 bp
  • A to G, chromosome 18 at 78,192,119 bp
  • T to A, chromosome 19 at 7,785,286 bp
  • T to A, chromosome 19 at 13,410,991 bp
  • T to C, chromosome 19 at 18,778,665 bp
  • T to C, chromosome 19 at 59,169,984 bp
  • G to A, chromosome X at 74,306,855 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7558 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045625-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.