Strain Name:
C57BL/6J-MtgxR7645Btlr/Mmmh
Stock Number:
045701-MU
Citation ID:
RRID:MMRRC_045701-MU
Other Names:
R7645 (G1)
Major Collection:

Strain Information

Esco2
Name: establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms: D030072L07Rik, 2410004I17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71988
Homologene: 12432
Dusp16
Name: dual specificity phosphatase 16
Synonyms: MKP-7, MKP7, 3830417M17Rik, D6Ertd213e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70686
Homologene: 15604
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Rufy3
Name: RUN and FYVE domain containing 3
Synonyms: 2810428M05Rik, 6330416M07Rik, D5Bwg0860e, Rpipx
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52822
Homologene: 87809
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: sodium/potassium/chloride cotransporters, mBSC2, Nkcc1, sy-ns
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20496
VEGA: 18
Homologene: 20283
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Atg2b
Name: autophagy related 2B
Synonyms: C630028L02Rik, C030004M05Rik, 2410024A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Rab5b
Name: RAB5B, member RAS oncogene family
Synonyms: C030027M18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19344
VEGA: 10
HGNC: HGNC:9784
Homologene: 104027
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Slc49a4
Name: solute carrier family 49 member 4
Synonyms: RCC4, Dirc2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224132
Homologene: 13137
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr21, Gpcr3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik, sao
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68750
Homologene: 2218
Ms4a6b
Name: membrane-spanning 4-domains, subfamily A, member 6B
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69774
Homologene: 128306
Polr3g
Name: polymerase (RNA) III (DNA directed) polypeptide G
Synonyms: RPC32, 2310047G20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67486
Homologene: 38184
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Bcat2
Name: branched chain aminotransferase 2, mitochondrial
Synonyms: Eca40, Bcat-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12036
HGNC: HGNC:977
Homologene: 81684
Muc6
Name: mucin 6, gastric
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353328
HGNC: HGNC:7517
Homologene: 18768
Fbxl4
Name: F-box and leucine-rich repeat protein 4
Synonyms: FBL5, FBL4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269514
Homologene: 8128
Cpt2
Name: carnitine palmitoyltransferase 2
Synonyms: CPTII, CPT II
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12896
HGNC: HGNC:2330
Homologene: 77
Zc3h12d
Name: zinc finger CCCH type containing 12D
Synonyms: D730019B10Rik, TFL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237256
VEGA: 10
Homologene: 18225
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51938
Homologene: 12149
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
Coq2
Name: coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Synonyms: 2310002F18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71883
Homologene: 69192
Tmco6
Name: transmembrane and coiled-coil domains 6
Synonyms: 2410015B03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71983
VEGA: 18
Homologene: 12431
Tbc1d9
Name: TBC1 domain family, member 9
Synonyms: C76116, 4933431N12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71310
Homologene: 57079
Tyro3
Name: TYRO3 protein tyrosine kinase 3
Synonyms: Sky, Dtk, Etk-2, Tif, Brt, Rse, Sky
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22174
Homologene: 4585
Polg2
Name: polymerase (DNA directed), gamma 2, accessory subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50776
HGNC: HGNC:9180
Homologene: 5221
Adgrg3
Name: adhesion G protein-coupled receptor G3
Synonyms: Pb99, A030001G24Rik, Gpr97
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54672
Homologene: 18129
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Amn1
Name: antagonist of mitotic exit network 1
Synonyms: C730024G19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232566
Homologene: 45811
Fut10
Name: fucosyltransferase 10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 171167
Homologene: 32790
Krt7
Name: keratin 7
Synonyms: K7, D15Wsu77e, Cytokeratin 7, Krt2-7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110310
HGNC: HGNC:6445
Homologene: 4058
Tcte1
Name: t-complex-associated testis expressed 1
Synonyms: Tcte-1, D17Sil1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21645
VEGA: 17
Homologene: 8434
Ltc4s
Name: leukotriene C4 synthase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17001
HGNC: HGNC:6719
Homologene: 7406
Or5b108
Name: olfactory receptor family 5 subfamily B member 108
Synonyms: GA_x6K02T2RE5P-3517488-3518411, MOR202-13, Olfr1462
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258688
HGNC: HGNC:8324
Homologene: 133607
Or4x11
Name: olfactory receptor family 4 subfamily X member 11
Synonyms: GA_x6K02T2Q125-51469027-51469956, MOR228-2, Olfr1265
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258340
Homologene: 133727
H2-M3
Name: histocompatibility 2, M region locus 3
Synonyms: Hmt, H-2M3, R4B2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14991
HGNC: HGNC:4964
Homologene: 133255
Actbl2
Name: actin, beta-like 2
Synonyms: 4732495G21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238880
Homologene: 134276
Samd11
Name: sterile alpha motif domain containing 11
Synonyms: mr-s
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 231004
VEGA: 4
Homologene: 34983
Psmb8
Name: proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7)
Synonyms: Lmp-7, Lmp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16913
HGNC: HGNC:9545
Homologene: 56499
Srgn
Name: serglycin
Synonyms: Sgc, Prg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19073
HGNC: HGNC:9361
Homologene: 137238
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 38,021,363 bp
  • C to A, chromosome 2 at 76,899,681 bp
  • T to A, chromosome 2 at 90,037,747 bp
  • T to C, chromosome 2 at 119,816,906 bp
  • T to C, chromosome 3 at 33,825,169 bp
  • T to C, chromosome 4 at 22,377,037 bp
  • C to T, chromosome 4 at 90,224,777 bp
  • A to T, chromosome 4 at 107,906,974 bp
  • A to G, chromosome 4 at 133,211,329 bp
  • T to C, chromosome 4 at 156,255,183 bp
  • A to G, chromosome 5 at 88,640,617 bp
  • A to C, chromosome 5 at 100,660,250 bp
  • A to G, chromosome 6 at 134,725,925 bp
  • C to T, chromosome 6 at 149,185,031 bp
  • T to A, chromosome 7 at 45,587,963 bp
  • T to C, chromosome 7 at 141,648,658 bp
  • A to G, chromosome 8 at 31,236,204 bp
  • A to T, chromosome 8 at 83,242,553 bp
  • A to G, chromosome 8 at 95,034,764 bp
  • T to C, chromosome 9 at 49,565,003 bp
  • A to G, chromosome 9 at 105,767,198 bp
  • T to A, chromosome 9 at 109,114,412 bp
  • T to C, chromosome 9 at 114,613,637 bp
  • A to G, chromosome 10 at 7,867,576 bp
  • C to T, chromosome 10 at 62,494,978 bp
  • G to A, chromosome 10 at 128,681,391 bp
  • T to C, chromosome 11 at 50,238,546 bp
  • A to T, chromosome 11 at 106,775,593 bp
  • T to C, chromosome 12 at 88,176,258 bp
  • T to C, chromosome 12 at 105,623,430 bp
  • T to C, chromosome 13 at 37,931,034 bp
  • T to C, chromosome 13 at 81,694,444 bp
  • T to A, chromosome 13 at 111,256,255 bp
  • T to C, chromosome 14 at 65,827,181 bp
  • C to T, chromosome 14 at 121,597,663 bp
  • T to C, chromosome 15 at 81,780,602 bp
  • C to T, chromosome 15 at 86,235,541 bp
  • T to C, chromosome 15 at 101,412,643 bp
  • T to A, chromosome 16 at 35,734,068 bp
  • TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,295 bp
  • T to C, chromosome 17 at 34,200,212 bp
  • T to A, chromosome 17 at 37,270,729 bp
  • A to G, chromosome 17 at 45,534,989 bp
  • A to G, chromosome 18 at 5,099,663 bp
  • C to T, chromosome 18 at 36,735,393 bp
  • T to C, chromosome 18 at 57,896,378 bp
  • A to T, chromosome 19 at 11,523,940 bp
  • T to C, chromosome 19 at 13,191,573 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7645 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045701-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.