Strain Name:
C57BL/6J-MtgxR7625Btlr/Mmmh
Stock Number:
045719-MU
Citation ID:
RRID:MMRRC_045719-MU
Other Names:
R7625 (G1)
Major Collection:

Strain Information

Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Dgat1
Name: diacylglycerol O-acyltransferase 1
Synonyms: D15Ertd23e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13350
HGNC: HGNC:2843
Homologene: 7688
Anxa4
Name: annexin A4
Synonyms: Anx4, Xanx-4, annexin IV, AIV
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11746
HGNC: HGNC:542
Homologene: 68164
Col6a1
Name: collagen, type VI, alpha 1
Synonyms: Col6a-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12833
HGNC: HGNC:2211
Homologene: 1391
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Atf1
Name: activating transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11908
HGNC: HGNC:783
Homologene: 3790
Ago1
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236511
HGNC: HGNC:3262
Homologene: 81826
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Nrf1
Name: nuclear respiratory factor 1
Synonyms: D6Ertd415e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18181
HGNC: HGNC:7996
Homologene: 3674
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223870
Homologene: 8731
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Hsph1
Name: heat shock 105kDa/110kDa protein 1
Synonyms: hsp-E7I, HSP110, Hsp105, hsp110/105
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15505
Homologene: 21322
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Aars1
Name: alanyl-tRNA synthetase 1
Synonyms: Aars
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234734
HGNC: HGNC:20
Homologene: 1213
Hmgb1
Name: high mobility group box 1
Synonyms: Hmg1, HMG-1, p30, SBP-1, amphoterin, DEF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15289
HGNC: HGNC:4983
Homologene: 135819
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Lifr
Name: LIF receptor alpha
Synonyms: soluble differentiation-stimulating factor receptor, A230075M04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16880
VEGA: 15
HGNC: HGNC:6597
Homologene: 1735
Tpst2
Name: protein-tyrosine sulfotransferase 2
Synonyms: grm, D5Ucla3, grt, Tango13b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22022
Homologene: 2666
Zfp566
Name: zinc finger protein 566
Synonyms: 2700043M03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72556
Homologene: 88470
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Pirt
Name: phosphoinositide-interacting regulator of transient receptor potential channels
Synonyms: Pirt, A530088H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193003
Homologene: 77645
Acaa2
Name: acetyl-CoA acyltransferase 2
Synonyms: 0610011L04Rik, D18Ertd240e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52538
VEGA: 18
HGNC: HGNC:83
Homologene: 4456
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Uggt2
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 3110001A05Rik, 1810064L21Rik, 3110027P15Rik, A230065J02Rik, Ugcgl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66435
Homologene: 56875
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Apoa4
Name: apolipoprotein A-IV
Synonyms: Apoa-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11808
HGNC: HGNC:602
Homologene: 47927
Sh3rf1
Name: SH3 domain containing ring finger 1
Synonyms: Posh, 2200003J05Rik, Sh3md2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59009
Homologene: 10988
Intu
Name: inturned planar cell polarity protein
Synonyms: 9430087H23Rik, 9230116I04Rik, Pdzk6, Pdzd6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 380614
Homologene: 41059
Kcnn3
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: small conductance calcium-activated potassium channel 3, SK3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140493
HGNC: HGNC:6292
Homologene: 20516
Clstn3
Name: calsyntenin 3
Synonyms: Cst-3, CSTN3, alcadein-beta, Clstn3b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232370
Homologene: 22836
Chl1
Name: cell adhesion molecule L1-like
Synonyms: CALL, A530023M13Rik, close homolog of L1, LICAM2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12661
HGNC: HGNC:1939
Homologene: 21314
Rgs17
Name: regulator of G-protein signaling 17
Synonyms: RGSZ2, 6430507P11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56533
Homologene: 8242
Ms4a4a
Name: membrane-spanning 4-domains, subfamily A, member 4A
Synonyms: EG666907
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 666907
Homologene: 103874
Gp6
Name: glycoprotein 6 platelet
Synonyms: Gpvi, 9830166G18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243816
Homologene: 9488
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Dpy19l3
Name: dpy-19 like C-mannosyltransferase 3
Synonyms: 9330164H19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233115
Homologene: 18692
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Or6k4
Name: olfactory receptor family 6 subfamily K member 4
Synonyms: GA_x6K02T2P20D-21025190-21024243, MOR105-2, Olfr424
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258716
Homologene: 103798
Nfe2l1
Name: nuclear factor, erythroid derived 2,-like 1
Synonyms: TCF-11, NRF1, LCR-F1, TCF11, Lcrf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18023
HGNC: HGNC:7781
Homologene: 20685
Cactin
Name: cactin, spliceosome C complex subunit
Synonyms: 2510012J08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70312
VEGA: 10
Homologene: 69553
Cpb2
Name: carboxypeptidase B2
Synonyms: thrombin-activatable fibrinolysis inhibitor, CPU, carboxypeptidase U, TAFI, 1110032P04Rik, carboxypeptidase R, CPR, 4930405E17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56373
VEGA: 14
HGNC: HGNC:2300
Homologene: 55610
Hscb
Name: HscB iron-sulfur cluster co-chaperone
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100900
Homologene: 13945
Atp8b3
Name: ATPase, class I, type 8B, member 3
Synonyms: SAPLT, 1700042F02Rik, 1700056N23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67331
VEGA: 10
Homologene: 19034
Nod2
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: F830032C23Rik, Card15, Nlrc2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257632
HGNC: HGNC:5331
Homologene: 11156
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Mindy4
Name: MINDY lysine 48 deubiquitinase 4
Synonyms: LOC384387, C330043M08Rik, Fam188b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330323
Homologene: 49991
Cyp2c38
Name: cytochrome P450, family 2, subfamily c, polypeptide 38
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13097
Homologene: 117948
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Nherf4
Name: NHERF family PDZ scaffold protein 4
Synonyms: sodium-phosphate cotransporter IIa C-terminal-associated protein 2, NaPi-Cap2, Pdzk2, Pdzd3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 170761
VEGA: 9
Homologene: 11719
Fhit
Name: fragile histidine triad gene
Synonyms: Fra14A2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14198
HGNC: HGNC:3701
Homologene: 21661
Tex44
Name: testis expressed 44
Synonyms: 1700019O17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71863
Homologene: 51874
Fam241b
Name: family with sequence similarity 241, member B
Synonyms: 2010107G23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69894
Homologene: 12338
Enkd1
Name: enkurin domain containing 1
Synonyms: E130303B06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102124
Homologene: 12957
Or52a33
Name: olfactory receptor family 52 subfamily A member 33
Synonyms: GA_x6K02T2PBJ9-6362863-6361910, MOR26-1, Olfr622
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259087
Homologene: 100540
Oog1
Name: oogenesin 1
Synonyms: c-1, Oog
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 193322
VEGA: 12
Homologene: 103830
Zfp994
Name: zinc finger protein 994
Synonyms: Gm4944
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240038
VEGA: 17
Homologene: 133246
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Zfp1002
Name: zinc finger protein 1002
Synonyms: Gm21994
Type: Gene
Species: Mouse
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 65,267,877 bp
  • A to T, chromosome 1 at 86,426,737 bp
  • G to C, chromosome 1 at 135,467,745 bp
  • G to A, chromosome 1 at 174,137,167 bp
  • G to A, chromosome 2 at 45,002,572 bp
  • T to C, chromosome 2 at 150,254,600 bp
  • T to C, chromosome 3 at 40,697,599 bp
  • C to A, chromosome 3 at 89,609,670 bp
  • T to G, chromosome 3 at 127,052,800 bp
  • G to A, chromosome 4 at 126,443,229 bp
  • T to A, chromosome 4 at 137,564,938 bp
  • A to T, chromosome 4 at 143,572,251 bp
  • T to C, chromosome 5 at 101,855,386 bp
  • T to A, chromosome 5 at 110,829,146 bp
  • G to A, chromosome 5 at 111,285,219 bp
  • C to A, chromosome 5 at 112,308,021 bp
  • T to C, chromosome 5 at 149,050,340 bp
  • A to G, chromosome 5 at 149,618,436 bp
  • G to A, chromosome 6 at 30,116,231 bp
  • T to C, chromosome 6 at 55,276,613 bp
  • T to C, chromosome 6 at 86,737,819 bp
  • T to A, chromosome 6 at 103,729,125 bp
  • G to T, chromosome 6 at 124,437,418 bp
  • T to C, chromosome 7 at 4,370,174 bp
  • A to G, chromosome 7 at 30,078,505 bp
  • T to A, chromosome 7 at 35,752,681 bp
  • A to G, chromosome 7 at 103,639,958 bp
  • G to A, chromosome 7 at 139,938,017 bp
  • T to A, chromosome 8 at 61,372,722 bp
  • A to T, chromosome 8 at 88,665,278 bp
  • A to G, chromosome 8 at 105,704,633 bp
  • A to T, chromosome 8 at 110,541,844 bp
  • T to A, chromosome 8 at 111,046,955 bp
  • A to T, chromosome 9 at 7,566,217 bp
  • A to T, chromosome 9 at 44,250,297 bp
  • A to T, chromosome 9 at 46,243,112 bp
  • A to T, chromosome 10 at 5,841,488 bp
  • A to T, chromosome 10 at 40,848,052 bp
  • A to G, chromosome 10 at 62,134,700 bp
  • A to G, chromosome 10 at 76,713,926 bp
  • A to G, chromosome 10 at 79,542,709 bp
  • A to C, chromosome 10 at 80,520,146 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • A to C, chromosome 11 at 66,925,943 bp
  • G to T, chromosome 11 at 70,395,434 bp
  • G to A, chromosome 11 at 96,819,445 bp
  • T to C, chromosome 12 at 87,608,312 bp
  • T to A, chromosome 12 at 118,196,642 bp
  • T to A, chromosome 14 at 9,870,177 bp
  • G to A, chromosome 14 at 52,237,077 bp
  • G to A, chromosome 14 at 75,272,549 bp
  • T to A, chromosome 14 at 119,026,493 bp
  • T to C, chromosome 15 at 7,169,242 bp
  • T to C, chromosome 15 at 76,503,195 bp
  • A to G, chromosome 15 at 98,066,798 bp
  • A to G, chromosome 15 at 100,254,277 bp
  • T to C, chromosome 17 at 18,105,431 bp
  • T to A, chromosome 17 at 22,201,755 bp
  • G to A, chromosome 18 at 37,726,901 bp
  • G to A, chromosome 18 at 60,952,340 bp
  • G to T, chromosome 18 at 74,804,142 bp
  • T to A, chromosome 19 at 11,390,364 bp
  • T to A, chromosome 19 at 39,462,924 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7625 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045719-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.