Strain Name:
C57BL/6J-MtgxR7646Btlr/Mmmh
Stock Number:
045724-MU
Citation ID:
RRID:MMRRC_045724-MU
Other Names:
R7646 (G1)
Major Collection:

Strain Information

Tnfsf4
Name: tumor necrosis factor (ligand) superfamily, member 4
Synonyms: OX40L, gp34, Txgp1l, Ath-1, TXGP1, CD134L, Ath1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22164
Homologene: 2495
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Syt4
Name: synaptotagmin IV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20983
VEGA: 18
Homologene: 7559
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Lig3
Name: ligase III, DNA, ATP-dependent
Synonyms: D11Wsu78e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16882
HGNC: HGNC:6600
Homologene: 32109
Nup98
Name: nucleoporin 98
Synonyms: Nup96
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269966
HGNC: HGNC:8068
Homologene: 35472
Dlgap5
Name: DLG associated protein 5
Synonyms: Hurp, C86398, Dlg7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218977
Homologene: 8840
Banp
Name: BTG3 associated nuclear protein
Synonyms: SMAR1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 53325
Homologene: 9635
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Emsy
Name: EMSY, BRCA2-interacting transcriptional repressor
Synonyms: 2210018M11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233545
Homologene: 32465
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Gbf1
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107338
HGNC: HGNC:4181
Homologene: 37897
Fh1
Name: fumarate hydratase 1
Synonyms: fumarase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14194
HGNC: HGNC:3700
Homologene: 115
Glyr1
Name: glyoxylate reductase 1 homolog (Arabidopsis)
Synonyms: Npac, 2810419J22Rik, 3930401K13Rik, NDF
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74022
VEGA: 16
Homologene: 12525
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Zfp37
Name: zinc finger protein 37
Synonyms: Tzn, Zfp-37
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22696
Homologene: 40682
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Afg3l1
Name: AFG3-like AAA ATPase 1
Synonyms: 3110061K15Rik, 1700047G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 114896
HGNC: HGNC:314
Homologene: 134198
Atl2
Name: atlastin GTPase 2
Synonyms: Aip-2, 2010110I21Rik, Arl6ip2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56298
VEGA: 17
Homologene: 56949
Ice1
Name: interactor of little elongation complex ELL subunit 1
Synonyms: BC018507
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218333
VEGA: 13
Homologene: 18902
Rufy1
Name: RUN and FYVE domain containing 1
Synonyms: Rabip4, 3000002E04Rik, ZFYVE12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216724
Homologene: 23522
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Nlrp4a
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp-eta, E330028A19Rik, Nalp4a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243880
Homologene: 79696
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Stradb
Name: STE20-related kinase adaptor beta
Synonyms: PRO1038, D1Ucla2, Als2cr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227154
Homologene: 10237
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70417
Homologene: 23771
Hoxa7
Name: homeobox A7
Synonyms: Hox-1.1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15404
HGNC: HGNC:5108
Homologene: 56001
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Trim34b
Name: tripartite motif-containing 34B
Synonyms: Trim34-2, Gm15134
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434218
Homologene: 128238
Or14j10
Name: olfactory receptor family 14 subfamily J member 10
Synonyms: GA_x6K02T2PSCP-2084102-2083137, MOR218-2, Olfr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258625
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: MJAM, OATP-D, 5830414C08Rik, Anr1, Slc21a11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108116
Homologene: 40862
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Ndst2
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms: glucosaminyl N-deacetylase/N-sulphotransferase-2, Mndns, [Heparan sulfate]-glucosamine N-sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17423
VEGA: 14
HGNC: HGNC:7681
Homologene: 20803
Or51ai2
Name: olfactory receptor family 51 subfamily AI member 2
Synonyms: GA_x6K02T2PBJ9-6671256-6672209, MOR2-1, Olfr632
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259123
Homologene: 64963
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Zfp108
Name: zinc finger protein 108
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54678
Homologene: 117959
Glp1r
Name: glucagon-like peptide 1 receptor
Synonyms: GLP-1R, GLP1Rc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14652
VEGA: 17
HGNC: HGNC:4324
Homologene: 1558
Xkr6
Name: X-linked Kx blood group related 6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219149
Homologene: 18287
Zfp426
Name: zinc finger protein 426
Synonyms: KRAB1, Zfp68-rs1, Zfo61, 2900057C04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235028
Homologene: 23435
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Ildr1
Name: immunoglobulin-like domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106347
Homologene: 15892
Zfp954
Name: zinc finger protein 954
Synonyms: 5730403M16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232853
Homologene: 129792
Mcmdc2
Name: minichromosome maintenance domain containing 2
Synonyms: 6030422M02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240697
Homologene: 18309
Elf5
Name: E74-like factor 5
Synonyms: ESE-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13711
HGNC: HGNC:3320
Homologene: 135967
Vmn2r24
Name: vomeronasal 2, receptor 24
Synonyms: EG243628
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243628
Homologene: 135915
Or13a27
Name: olfactory receptor family 13 subfamily A member 27
Synonyms: IH6, MOR253-6, GA_x6K02T2PBJ9-42496183-42495251, Olfr60
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18361
Homologene: 34961
Or8k37
Name: olfactory receptor family 8 subfamily K member 37
Synonyms: GA_x6K02T2Q125-48121788-48120847, MOR192-3, MOR192-2, Olfr1084
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258235
Homologene: 104285
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Mrpl38
Name: mitochondrial ribosomal protein L38
Synonyms: MRP-L3, Rpml3, 4733401F03Rik, 1110036N21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 60441
Homologene: 11476
Sesn3
Name: sestrin 3
Synonyms: SEST3, 5630400E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75747
Homologene: 14386
Or12e8
Name: olfactory receptor family 12 subfamily E member 8
Synonyms: GA_x6K02T2Q125-48849180-48850100, MOR264-2, Olfr1120
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259031
Homologene: 72054
Klk1b22
Name: kallikrein 1-related peptidase b22
Synonyms: mGk-22, Egfbp-1, Egfbp1, Klk22
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13646
Homologene: 68141
Septin8
Name: septin 8
Synonyms: Sepl, Sept8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20362
Homologene: 57205
Slc25a23
Name: solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms: 2310067G05Rik, SCaMC-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66972
Homologene: 11467
Polr3h
Name: polymerase (RNA) III (DNA directed) polypeptide H
Synonyms: RPC8, 5031409G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78929
VEGA: 15
Homologene: 6337
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,912,135 bp
  • T to C, chromosome 1 at 24,028,623 bp
  • A to T, chromosome 1 at 58,994,408 bp
  • A to G, chromosome 1 at 161,417,162 bp
  • C to T, chromosome 1 at 175,614,913 bp
  • A to G, chromosome 2 at 29,177,549 bp
  • T to C, chromosome 2 at 66,287,758 bp
  • C to A, chromosome 2 at 86,639,169 bp
  • A to G, chromosome 2 at 87,357,758 bp
  • G to T, chromosome 2 at 103,439,243 bp
  • T to G, chromosome 4 at 62,191,295 bp
  • T to A, chromosome 4 at 113,763,542 bp
  • T to A, chromosome 4 at 141,021,655 bp
  • T to C, chromosome 4 at 156,195,354 bp
  • A to T, chromosome 5 at 14,520,895 bp
  • A to T, chromosome 6 at 18,375,940 bp
  • A to G, chromosome 6 at 52,215,719 bp
  • T to A, chromosome 6 at 123,816,210 bp
  • A to T, chromosome 7 at 6,709,222 bp
  • G to A, chromosome 7 at 7,115,721 bp
  • A to G, chromosome 7 at 24,261,415 bp
  • C to G, chromosome 7 at 26,449,562 bp
  • T to G, chromosome 7 at 44,116,118 bp
  • A to G, chromosome 7 at 56,134,613 bp
  • G to T, chromosome 7 at 73,435,773 bp
  • G to A, chromosome 7 at 74,504,596 bp
  • G to A, chromosome 7 at 98,619,353 bp
  • A to C, chromosome 7 at 102,154,035 bp
  • G to A, chromosome 7 at 103,938,297 bp
  • G to A, chromosome 7 at 104,335,352 bp
  • A to G, chromosome 7 at 120,514,714 bp
  • A to T, chromosome 7 at 135,696,769 bp
  • A to G, chromosome 7 at 140,345,951 bp
  • T to A, chromosome 8 at 11,445,086 bp
  • T to C, chromosome 8 at 122,024,036 bp
  • C to A, chromosome 8 at 123,493,027 bp
  • A to G, chromosome 9 at 14,308,615 bp
  • A to T, chromosome 9 at 20,470,024 bp
  • T to C, chromosome 10 at 5,172,949 bp
  • T to C, chromosome 10 at 60,305,152 bp
  • T to A, chromosome 11 at 50,410,609 bp
  • T to A, chromosome 11 at 53,537,917 bp
  • A to G, chromosome 11 at 54,625,954 bp
  • T to A, chromosome 11 at 82,783,478 bp
  • G to A, chromosome 11 at 116,132,767 bp
  • A to G, chromosome 12 at 8,009,189 bp
  • A to G, chromosome 13 at 38,022,847 bp
  • A to G, chromosome 13 at 70,589,797 bp
  • G to A, chromosome 14 at 14,773,348 bp
  • A to G, chromosome 14 at 20,724,459 bp
  • C to T, chromosome 14 at 47,399,519 bp
  • G to T, chromosome 14 at 63,606,974 bp
  • A to G, chromosome 15 at 81,917,370 bp
  • T to C, chromosome 16 at 5,018,497 bp
  • T to A, chromosome 16 at 36,721,919 bp
  • A to G, chromosome 17 at 25,860,130 bp
  • G to A, chromosome 17 at 30,649,677 bp
  • A to G, chromosome 17 at 30,936,283 bp
  • G to T, chromosome 17 at 37,624,404 bp
  • C to T, chromosome 17 at 57,059,759 bp
  • A to G, chromosome 17 at 79,854,607 bp
  • A to C, chromosome 18 at 31,441,605 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • A to T, chromosome 19 at 18,867,961 bp
  • T to A, chromosome 19 at 46,283,672 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7646 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045724-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.