Strain Name:
C57BL/6J-MtgxR7773Btlr/Mmmh
Stock Number:
045829-MU
Citation ID:
RRID:MMRRC_045829-MU
Other Names:
R7773 (G1)
Major Collection:

Strain Information

Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Pcm1
Name: pericentriolar material 1
Synonyms: 9430077F19Rik, 2600002H09Rik, C030044G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18536
HGNC: HGNC:8727
Homologene: 4518
Sirt1
Name: sirtuin 1
Synonyms: Sir2, Sir2alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 93759
Homologene: 56556
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Smc4
Name: structural maintenance of chromosomes 4
Synonyms: 2500002A22Rik, Smc4l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70099
Homologene: 4015
Tlr4
Name: toll-like receptor 4
Synonyms: Lps, Rasl2-8, lipopolysaccharide response
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
Serinc5
Name: serine incorporator 5
Synonyms: AIGP3, A130038L21Rik, TPO1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218442
VEGA: 13
Homologene: 65246
Jak3
Name: Janus kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16453
HGNC: HGNC:6193
Homologene: 181
Cd200r1
Name: CD200 receptor 1
Synonyms: OX2R, CD200R, Mox2r
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57781
Homologene: 10957
H13
Name: histocompatibility 13
Synonyms: H-13, 1200006O09Rik, 5031424B04Rik, 4930443L17Rik, Spp, Hm13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14950
Homologene: 7749
Ppp3ca
Name: protein phosphatase 3, catalytic subunit, alpha isoform
Synonyms: PP2B alpha 1, PP2BA alpha, CnA, Caln, Calna, 2900074D19Rik, CN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19055
HGNC: HGNC:9314
Homologene: 55497
Farsa
Name: phenylalanyl-tRNA synthetase, alpha subunit
Synonyms: 0610012A19Rik, Farsla
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66590
HGNC: HGNC:3592
Homologene: 3280
Edem3
Name: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: 2310050N11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66967
Homologene: 11866
Poc5
Name: POC5 centriolar protein
Synonyms: 1200014M14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67463
VEGA: 13
Homologene: 12141
Osbpl7
Name: oxysterol binding protein-like 7
Synonyms: 4933437E18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71240
Homologene: 79672
Elp6
Name: elongator acetyltransferase complex subunit 6
Synonyms: 2610001P13Rik, Tmem103, 2610002I17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72341
Homologene: 9794
Rpl10l
Name: ribosomal protein L10-like
Synonyms: EG238217
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238217
Homologene: 68830
Cd8a
Name: CD8 subunit alpha
Synonyms: Ly-B, Ly-35, Ly-2, Lyt-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12525
HGNC: HGNC:1706
Homologene: 133777
AAdacl4fm3
Name: AADACL4 family member 3
Synonyms: Gm13178
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 546849
Homologene: 82586
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Prl6a1
Name: prolactin family 6, subfamily a, member 1
Synonyms: PLP-B, Prlpb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19111
Homologene: 49261
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Amigo3
Name: adhesion molecule with Ig like domain 3
Synonyms: E430002N15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320844
Homologene: 45570
Fam234b
Name: family with sequence similarity 234, member B
Synonyms: 8430419L09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74525
Homologene: 12572
1700006A11Rik
Name: RIKEN cDNA 1700006A11 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71824
Aoc1
Name: amine oxidase, copper-containing 1
Synonyms: 1600012D06Rik, Abp1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76507
HGNC: HGNC:80
Homologene: 68159
4930568D16Rik
Name: RIKEN cDNA 4930568D16 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75859
Homologene: 86865
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Tgfbr3
Name: transforming growth factor, beta receptor III
Synonyms: betaglycan, TBRIII, 1110036H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21814
Homologene: 2436
Hip1r
Name: huntingtin interacting protein 1 related
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 29816
Homologene: 78348
Ccdc83
Name: coiled-coil domain containing 83
Synonyms: 4930549K11Rik, 4930554C01Rik, 4932423M01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75338
Homologene: 32709
Cpvl
Name: carboxypeptidase, vitellogenic-like
Synonyms: 4933436L16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71287
Homologene: 80235
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Krtap4-23
Name: keratin associated protein 4-23
Synonyms: Gm11596
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 670464
Homologene: 124486
Krt7
Name: keratin 7
Synonyms: K7, D15Wsu77e, Cytokeratin 7, Krt2-7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110310
HGNC: HGNC:6445
Homologene: 4058
Ccdc63
Name: coiled-coil domain containing 63
Synonyms: 4921511C16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330188
Homologene: 45136
Cacnb3
Name: calcium channel, voltage-dependent, beta 3 subunit
Synonyms: Cchb3, Beta3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12297
VEGA: 15
HGNC: HGNC:1403
Homologene: 20187
Tsga10
Name: testis specific 10
Synonyms: 4933432N21Rik, Mtsga10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211484
Homologene: 23531
Cnnm4
Name: cyclin M4
Synonyms: Acdp4, 5430430O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94220
HGNC: HGNC:105
Homologene: 75662
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 280635
Homologene: 18817
Or5b113
Name: olfactory receptor family 5 subfamily B member 113
Synonyms: GA_x6K02T2RE5P-3695694-3696620, MOR202-15, Olfr1467
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258686
Homologene: 133888
Foxf2
Name: forkhead box F2
Synonyms: FREAC2, Fkh20, LUN
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14238
HGNC: HGNC:3810
Homologene: 1115
Vmn2r50
Name: vomeronasal 2, receptor 50
Synonyms: EG434117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434117
Homologene: 113703
Vmn1r15
Name: vomeronasal 1 receptor 15
Synonyms: V1rc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113863
Homologene: 123826
Nt5el
Name: 5' nucleotidase, ecto-like
Synonyms: 4933425L06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66763
Homologene: 12028
Or8k21
Name: olfactory receptor family 8 subfamily K member 21
Synonyms: GA_x6K02T2Q125-47793414-47792471, MOR187-4, Olfr1053-ps1, Olfr1053
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257974
Homologene: 74197
Sod3
Name: superoxide dismutase 3, extracellular
Synonyms: EC-SOD
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20657
Homologene: 2334
Chid1
Name: chitinase domain containing 1
Synonyms: 3110023E09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68038
Homologene: 12229
Ldc1
Name: leucine decarboxylase 1
Synonyms: LOC332942, Gm853
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 332942
Homologene: 128653
Iqcf4
Name: IQ motif containing F4
Synonyms: 1700042N06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67320
Homologene: 122079
Trub2
Name: TruB pseudouridine (psi) synthase family member 2
Synonyms: G430055L02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227682
Homologene: 41056
Rnf149
Name: ring finger protein 149
Synonyms: 1600023E10Rik, Greul4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67702
Homologene: 18337
Psmd6
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: 2400006A19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66413
HGNC: HGNC:9564
Homologene: 7157
Gm9817
Name: predicted gene 9817
Type: Gene
Species: Mouse
Chromosome: 13
4930519P11Rik
Name: RIKEN cDNA 4930519P11 gene
Type: Gene
Species: Mouse
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,499,522 bp
  • A to T, chromosome 1 at 37,835,242 bp
  • A to C, chromosome 1 at 39,565,218 bp
  • T to C, chromosome 1 at 126,026,844 bp
  • A to T, chromosome 1 at 151,811,596 bp
  • A to G, chromosome 1 at 176,740,076 bp
  • G to T, chromosome 2 at 29,786,508 bp
  • C to T, chromosome 2 at 35,354,594 bp
  • T to C, chromosome 2 at 86,314,690 bp
  • A to G, chromosome 2 at 152,695,511 bp
  • T to C, chromosome 2 at 154,613,187 bp
  • A to T, chromosome 2 at 160,910,798 bp
  • A to G, chromosome 3 at 69,016,163 bp
  • A to G, chromosome 3 at 88,895,795 bp
  • A to G, chromosome 3 at 124,412,531 bp
  • A to G, chromosome 3 at 136,890,461 bp
  • T to C, chromosome 4 at 66,839,599 bp
  • T to C, chromosome 4 at 130,220,376 bp
  • A to T, chromosome 4 at 144,703,477 bp
  • A to G, chromosome 5 at 41,832,712 bp
  • A to C, chromosome 5 at 52,368,301 bp
  • G to A, chromosome 5 at 73,607,321 bp
  • A to G, chromosome 5 at 107,140,502 bp
  • G to T, chromosome 5 at 122,109,272 bp
  • A to G, chromosome 5 at 124,001,441 bp
  • A to G, chromosome 6 at 48,906,212 bp
  • A to G, chromosome 6 at 53,931,905 bp
  • A to T, chromosome 6 at 57,258,659 bp
  • A to G, chromosome 6 at 71,373,815 bp
  • T to C, chromosome 6 at 83,979,214 bp
  • T to A, chromosome 6 at 135,243,914 bp
  • T to A, chromosome 7 at 10,037,635 bp
  • T to A, chromosome 7 at 76,698,837 bp
  • T to A, chromosome 7 at 90,229,912 bp
  • T to C, chromosome 7 at 141,529,605 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • G to T, chromosome 8 at 41,309,573 bp
  • A to C, chromosome 8 at 71,679,042 bp
  • T to C, chromosome 8 at 84,864,152 bp
  • T to C, chromosome 8 at 121,651,775 bp
  • T to C, chromosome 9 at 106,568,613 bp
  • T to C, chromosome 9 at 108,054,668 bp
  • T to A, chromosome 9 at 110,312,559 bp
  • T to A, chromosome 10 at 63,326,783 bp
  • A to G, chromosome 11 at 97,050,722 bp
  • A to T, chromosome 11 at 99,792,841 bp
  • T to C, chromosome 12 at 66,284,267 bp
  • T to C, chromosome 13 at 27,318,142 bp
  • T to C, chromosome 13 at 31,627,199 bp
  • C to T, chromosome 13 at 45,078,951 bp
  • T to C, chromosome 13 at 92,661,084 bp
  • A to G, chromosome 13 at 96,410,635 bp
  • A to G, chromosome 13 at 105,082,285 bp
  • GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC to GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC, chromosome 14 at 14,119,882 bp
  • C to T, chromosome 14 at 103,248,404 bp
  • T to C, chromosome 15 at 98,639,938 bp
  • A to C, chromosome 15 at 101,414,032 bp
  • A to G, chromosome 16 at 4,632,006 bp
  • A to G, chromosome 16 at 44,789,687 bp
  • T to A, chromosome 19 at 13,365,234 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045829-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.