Strain Name:
C57BL/6J-MtgxR7786Btlr/Mmmh
Stock Number:
045842-MU
Citation ID:
RRID:MMRRC_045842-MU
Other Names:
R7786 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Plin3
Name: perilipin 3
Synonyms: 1300012C15Rik, Tip47, M6prbp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66905
VEGA: 17
Homologene: 4247
Hdac11
Name: histone deacetylase 11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232232
Homologene: 11743
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Gatad2b
Name: GATA zinc finger domain containing 2B
Synonyms: C430014D17Rik, p66beta
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229542
Homologene: 32484
Emc8
Name: ER membrane protein complex subunit 8
Synonyms: Noc4, Fam158b, Cox4nb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18117
HGNC: HGNC:7864
Homologene: 4424
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
Gtf2ird1
Name: general transcription factor II I repeat domain-containing 1
Synonyms: WBSCR11, Cream1, GTF3, MusTRD1, binding factor for early enhancer, BEN, ESTM9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57080
HGNC: HGNC:4661
Homologene: 4158
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Adam18
Name: a disintegrin and metallopeptidase domain 18
Synonyms: Adam27, Dtgn3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13524
HGNC: HGNC:196
Homologene: 74941
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71685
Homologene: 56997
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: Hif1b, ESTM42, D3Ertd557e, bHLHe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
Vav2
Name: vav 2 oncogene
Synonyms: 2810040F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22325
Homologene: 2530
Top3a
Name: topoisomerase (DNA) III alpha
Synonyms: Top IIIa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21975
Homologene: 3394
Poc5
Name: POC5 centriolar protein
Synonyms: 1200014M14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67463
VEGA: 13
Homologene: 12141
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Katnip
Name: katanin interacting protein
Synonyms: D430042O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233865
Homologene: 45841
Acaa2
Name: acetyl-CoA acyltransferase 2
Synonyms: 0610011L04Rik, D18Ertd240e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52538
VEGA: 18
HGNC: HGNC:83
Homologene: 4456
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Pik3ap1
Name: phosphoinositide-3-kinase adaptor protein 1
Synonyms: BCAP, 1810044J04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83490
VEGA: 19
Homologene: 12848
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Xylt1
Name: xylosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233781
Homologene: 32534
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Akna
Name: AT-hook transcription factor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100182
Homologene: 49947
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b288Clo, b2b1702Clo, m687Ddg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Krt76
Name: keratin 76
Synonyms: 2310001L23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77055
Homologene: 22931
Fcrla
Name: Fc receptor-like A
Synonyms: FCRL1, FREB, Fcrx, Freb1, mFREB, mFcrX
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98752
Homologene: 13106
Or52p1
Name: olfactory receptor family 52 subfamily P member 1
Synonyms: GA_x6K02T2PBJ9-7245486-7246451, MOR27-1, Olfr656
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259078
Homologene: 128072
Hsd11b2
Name: hydroxysteroid 11-beta dehydrogenase 2
Synonyms: 11(beta)-HSD2, 11HSD2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15484
HGNC: HGNC:5209
Homologene: 20088
Cdr1
Name: cerebellar degeneration related antigen 1
Synonyms: Cdr34, Gm7077, Gm2409
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 631990
VEGA: X
HGNC: HGNC:1798
Try10
Name: trypsin 10
Synonyms: trypsinogen 10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 436522
Homologene: 134623
Nox4
Name: NADPH oxidase 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50490
HGNC: HGNC:7891
Homologene: 41065
Or5w16
Name: olfactory receptor family 5 subfamily W member 16
Synonyms: GA_x6K02T2Q125-49250025-49250960, MOR177-6, Olfr1140
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258635
Homologene: 74081
Cfap210
Name: cilia and flagella associated protein 210
Synonyms: 4930525K21Rik, 4930578N16Rik, Ccdc173
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75051
Homologene: 18989
Rgs7bp
Name: regulator of G-protein signalling 7 binding protein
Synonyms: A930030I01Rik, R7bp, D13Bwg1146e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 52882
VEGA: 13
Homologene: 78705
Mmp21
Name: matrix metallopeptidase 21
Synonyms: b2b873Clo, b2b2458Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214766
Homologene: 17519
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4930516C23Rik, 4921509E07Rik, Fam71d
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70897
Homologene: 49887
Tnfaip8
Name: tumor necrosis factor, alpha-induced protein 8
Synonyms: Gg2-1, Ssc-2, Nded, E130304C20Rik, Gm10539, Tipe
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106869
Homologene: 8649
Or51i2
Name: olfactory receptor family 51 subfamily I member 2
Synonyms: GA_x6K02T2PBJ9-6773690-6774628, MOR13-3, Olfr641
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259075
Homologene: 17489
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 135,469,995 bp
  • G to T, chromosome 1 at 170,920,857 bp
  • C to A, chromosome 2 at 27,386,601 bp
  • A to T, chromosome 2 at 69,781,748 bp
  • A to T, chromosome 2 at 87,746,301 bp
  • G to C, chromosome 2 at 91,767,796 bp
  • T to C, chromosome 3 at 90,355,679 bp
  • A to G, chromosome 3 at 95,484,956 bp
  • C to T, chromosome 3 at 133,082,107 bp
  • A to G, chromosome 4 at 63,394,962 bp
  • C to A, chromosome 5 at 115,863,018 bp
  • C to A, chromosome 5 at 134,390,899 bp
  • G to A, chromosome 6 at 23,036,993 bp
  • T to A, chromosome 6 at 41,355,529 bp
  • T to A, chromosome 6 at 91,173,176 bp
  • T to C, chromosome 7 at 25,317,695 bp
  • T to A, chromosome 7 at 87,295,842 bp
  • G to A, chromosome 7 at 104,040,723 bp
  • T to A, chromosome 7 at 104,617,718 bp
  • C to A, chromosome 7 at 117,643,475 bp
  • A to G, chromosome 7 at 125,865,294 bp
  • C to T, chromosome 7 at 133,675,035 bp
  • C to T, chromosome 8 at 24,611,118 bp
  • C to T, chromosome 8 at 85,085,456 bp
  • T to A, chromosome 8 at 105,518,874 bp
  • T to C, chromosome 8 at 120,667,917 bp
  • A to C, chromosome 11 at 36,010,449 bp
  • C to T, chromosome 11 at 60,776,966 bp
  • T to A, chromosome 12 at 78,719,629 bp
  • T to C, chromosome 12 at 85,266,737 bp
  • C to A, chromosome 13 at 96,404,519 bp
  • T to C, chromosome 13 at 105,054,060 bp
  • A to T, chromosome 14 at 31,262,521 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to A, chromosome 15 at 76,309,716 bp
  • T to A, chromosome 15 at 101,890,530 bp
  • A to T, chromosome 17 at 37,070,063 bp
  • G to A, chromosome 17 at 56,279,757 bp
  • T to A, chromosome 17 at 73,709,981 bp
  • G to C, chromosome 18 at 50,047,111 bp
  • C to T, chromosome 18 at 50,047,112 bp
  • T to C, chromosome 18 at 74,792,447 bp
  • A to G, chromosome 19 at 41,321,585 bp
  • AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC to AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC, chromosome X at 61,184,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7786 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045842-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.