Strain Name:
C57BL/6J-MtgxR7844Btlr/Mmmh
Stock Number:
045898-MU
Citation ID:
RRID:MMRRC_045898-MU
Other Names:
R7844 (G1)
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Gabrg1
Name: gamma-aminobutyric acid type A receptor subunit gamma 1
Synonyms: GabaA
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14405
HGNC: HGNC:4086
Homologene: 22570
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pk-3, Pk-2, Pk3, Pkm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Slc30a6
Name: solute carrier family 30 (zinc transporter), member 6
Synonyms: ZnT6, ZnT-6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210148
VEGA: 17
Homologene: 32380
Abcg5
Name: ATP binding cassette subfamily G member 5
Synonyms: Sterolin-1, trac, cmp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27409
Homologene: 31909
Dpp8
Name: dipeptidylpeptidase 8
Synonyms: 4932434F09Rik, 2310004I03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74388
VEGA: 9
Homologene: 57098
Mrpl49
Name: mitochondrial ribosomal protein L49
Synonyms: 4833419D18Rik, Nof1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18120
VEGA: 19
HGNC: HGNC:1176
Homologene: 37982
Rock1
Name: Rho-associated coiled-coil containing protein kinase 1
Synonyms: Rock-I, 1110055K06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19877
VEGA: 18
Homologene: 55899
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226432
Homologene: 5874
Pirb
Name: paired Ig-like receptor B
Synonyms: Gp91, Lilrb3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18733
Homologene: 134028
Hsd17b11
Name: hydroxysteroid (17-beta) dehydrogenase 11
Synonyms: Pan1b, retSDR2, Dhrs8, 17beta-HSD11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114664
Homologene: 69209
Snrnp48
Name: small nuclear ribonucleoprotein 48 (U11/U12)
Synonyms: 1110050F08Rik, 6530403A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67797
VEGA: 13
Homologene: 12191
Slc12a9
Name: solute carrier family 12 (potassium/chloride transporters), member 9
Synonyms: CIP1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83704
Homologene: 5429
Brd9
Name: bromodomain containing 9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105246
VEGA: 13
Homologene: 82462
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, LTRPC2, TRPC7, 9830168K16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: ZNFPR1B1, Prdm3, MDS1-EVI1, Evi-1, D630039M04Rik, Jbo, Evi1, Mds1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Gm4884
Name: predicted gene 4884
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233164
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70882
Homologene: 31589
Tpo
Name: thyroid peroxidase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22018
Homologene: 461
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, Sdccag33, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Gbp7
Name: guanylate binding protein 7
Synonyms: 9830147J24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229900
Homologene: 138296
Aadacl2fm2
Name: AADACL2 family member 2
Synonyms: Gm5538
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433597
Homologene: 79018
Or52d1
Name: olfactory receptor family 52 subfamily D member 1
Synonyms: GA_x6K02T2PBJ9-6841330-6842268, MOR33-2, Olfr646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259058
Homologene: 17481
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 4930558F19Rik, 9130422H11Rik, LOC100045280
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50770
Homologene: 75050
4930553M12Rik
Name: RIKEN cDNA 4930553M12 gene
Type: Gene
Species: Mouse
Chromosome: 4
Tada3
Name: transcriptional adaptor 3
Synonyms: ADA3, 1110004B19Rik, Tada3l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101206
Homologene: 4633
Krt7
Name: keratin 7
Synonyms: K7, D15Wsu77e, Cytokeratin 7, Krt2-7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110310
HGNC: HGNC:6445
Homologene: 4058
Gopc
Name: golgi associated PDZ and coiled-coil motif containing
Synonyms: GOPC1, 2210402P09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94221
VEGA: 10
Homologene: 10695
Spdl1
Name: spindle apparatus coiled-coil protein 1
Synonyms: 1700018I02Rik, 2810049B11Rik, 2600001J17Rik, Ccdc99
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70385
Homologene: 9837
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Serpine2
Name: serine (or cysteine) peptidase inhibitor, clade E, member 2
Synonyms: nexin, PN-1, PI7, protease nexin 1, Spi4, B230326M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20720
HGNC: HGNC:8951
Homologene: 21247
Tcl1b5
Name: T cell leukemia/lymphoma 1B, 5
Synonyms: D12Ertd644e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27382
VEGA: 12
Homologene: 83274
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Spaca7b
Name: sperm acrosome associated 7B
Synonyms: GC14, 1700016D06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76413
Timm44
Name: translocase of inner mitochondrial membrane 44
Synonyms: Tim44, Mimt44, D8Ertd118e, 0710005E20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21856
Homologene: 4631
Serpine1
Name: serine (or cysteine) peptidase inhibitor, clade E, member 1
Synonyms: PAI-1, PAI1, Planh1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18787
HGNC: HGNC:8583
Homologene: 68070
Spon1
Name: spondin 1, (f-spondin) extracellular matrix protein
Synonyms: D330035F22Rik, FSP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233744
Homologene: 4453
Klhdc2
Name: kelch domain containing 2
Synonyms: HCLP-1, 2310022K15Rik, D12Ertd522e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69554
Homologene: 8631
Inhbe
Name: inhibin beta-E
Synonyms: activin beta-E, activin betaE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16326
VEGA: 10
Homologene: 7381
Gpr15
Name: G protein-coupled receptor 15
Synonyms: 4933439K08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71223
VEGA: 16
HGNC: HGNC:4469
Homologene: 3869
Acox3
Name: acyl-Coenzyme A oxidase 3, pristanoyl
Synonyms: pristanoyl-CoA oxidase, PCOX, EST-s59
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80911
HGNC: HGNC:121
Homologene: 37792
Pigu
Name: phosphatidylinositol glycan anchor biosynthesis, class U
Synonyms: 5430426F17Rik, Cdc91l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228812
Homologene: 6553
Abhd6
Name: abhydrolase domain containing 6
Synonyms: 0610041D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66082
VEGA: 14
Homologene: 23246
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Gm9767
Name: predicted gene 9767
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100040851
VEGA: 10
Tysnd1
Name: trypsin domain containing 1
Synonyms: 1300019N10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71767
VEGA: 10
Homologene: 87946
Adora1
Name: adenosine A1 receptor
Synonyms: A1AR, A1R, A1-AR, Ri, AA1R, ARA1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11539
HGNC: HGNC:262
Homologene: 20165
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 79,816,799 bp
  • A to G, chromosome 1 at 134,203,538 bp
  • A to G, chromosome 1 at 135,394,324 bp
  • A to G, chromosome 2 at 19,254,018 bp
  • A to C, chromosome 2 at 155,292,720 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • T to G, chromosome 3 at 30,009,824 bp
  • A to T, chromosome 3 at 59,729,897 bp
  • G to T, chromosome 3 at 142,536,386 bp
  • T to C, chromosome 4 at 88,868,186 bp
  • C to A, chromosome 4 at 154,989,465 bp
  • A to T, chromosome 5 at 35,607,148 bp
  • T to C, chromosome 5 at 70,774,332 bp
  • T to A, chromosome 5 at 104,018,266 bp
  • T to C, chromosome 5 at 107,874,994 bp
  • C to A, chromosome 5 at 137,071,189 bp
  • T to C, chromosome 5 at 137,332,186 bp
  • C to T, chromosome 6 at 113,370,960 bp
  • A to T, chromosome 7 at 3,719,411 bp
  • A to T, chromosome 7 at 26,562,581 bp
  • A to C, chromosome 7 at 41,040,698 bp
  • T to G, chromosome 7 at 104,106,483 bp
  • G to A, chromosome 7 at 114,030,332 bp
  • A to G, chromosome 8 at 4,269,976 bp
  • G to T, chromosome 8 at 11,425,453 bp
  • A to T, chromosome 8 at 11,656,174 bp
  • A to G, chromosome 8 at 12,851,039 bp
  • G to A, chromosome 8 at 81,741,320 bp
  • A to G, chromosome 8 at 107,358,668 bp
  • A to T, chromosome 9 at 55,815,448 bp
  • A to G, chromosome 9 at 59,670,722 bp
  • A to G, chromosome 9 at 65,045,667 bp
  • A to T, chromosome 10 at 26,078,357 bp
  • T to C, chromosome 10 at 52,339,749 bp
  • C to T, chromosome 10 at 61,702,165 bp
  • A to G, chromosome 10 at 77,923,506 bp
  • T to C, chromosome 10 at 92,902,058 bp
  • A to G, chromosome 10 at 127,350,910 bp
  • A to T, chromosome 11 at 34,813,343 bp
  • C to A, chromosome 11 at 107,074,061 bp
  • A to G, chromosome 12 at 30,100,405 bp
  • T to A, chromosome 12 at 69,302,406 bp
  • C to A, chromosome 12 at 82,397,493 bp
  • T to G, chromosome 12 at 101,878,144 bp
  • G to A, chromosome 12 at 105,176,556 bp
  • A to G, chromosome 12 at 111,997,952 bp
  • A to G, chromosome 13 at 38,209,989 bp
  • A to G, chromosome 13 at 73,938,533 bp
  • A to C, chromosome 14 at 8,039,792 bp
  • T to C, chromosome 15 at 23,410,787 bp
  • G to A, chromosome 15 at 101,412,634 bp
  • A to T, chromosome 16 at 58,718,510 bp
  • G to A, chromosome 17 at 74,404,093 bp
  • A to T, chromosome 17 at 84,673,590 bp
  • T to G, chromosome 18 at 10,104,173 bp
  • T to C, chromosome 18 at 84,014,171 bp
  • C to T, chromosome 19 at 6,055,170 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7844 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045898-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.