Strain Name:
C57BL/6J-MtgxR7903Btlr/Mmmh
Stock Number:
045955-MU
Citation ID:
RRID:MMRRC_045955-MU
Other Names:
R7903 (G1)
Major Collection:

Strain Information

Aggf1
Name: angiogenic factor with G patch and FHA domains 1
Synonyms: 2310029P06Rik, VG5Q, 2010009L17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66549
Homologene: 41220
H2-D1
Name: histocompatibility 2, D region locus 1
Synonyms: H-2D
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14964
Homologene: 128352
Sult6b1
Name: sulfotransferase family, cytosolic, 6B, member 1
Synonyms: 2410078J06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73671
Homologene: 42242
Nsfl1c
Name: NSFL1 (p97) cofactor (p47)
Synonyms: p47
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 386649
Homologene: 41114
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Slc7a7
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonyms: my+lat1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20540
Homologene: 88701
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Pml
Name: promyelocytic leukemia
Synonyms: Trim19, 1200009E24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18854
HGNC: HGNC:9113
Homologene: 13245
Proser1
Name: proline and serine rich 1
Synonyms: 2810046L04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 212127
Homologene: 13463
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: Nedd4-2, 1300012C07Rik, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Epb41l3
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, 4.1B, DAL1P, Epb4.1l3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13823
HGNC: HGNC:3380
Homologene: 49308
Ccdc14
Name: coiled-coil domain containing 14
Synonyms: G630039H03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239839
VEGA: 16
Homologene: 32549
Ddb1
Name: damage specific DNA binding protein 1
Synonyms: p127-Ddb1, damage-specific DNA-binding protein, DNA repair, DNA repair protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13194
VEGA: 19
HGNC: HGNC:2717
Homologene: 1448
Mcm10
Name: minichromosome maintenance 10 replication initiation factor
Synonyms: C330019M07Rik, 2410041F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70024
Homologene: 41275
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Fubp1
Name: far upstream element (FUSE) binding protein 1
Synonyms: FBP, Fubp, Fubp4, 9530027K12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51886
HGNC: HGNC:4004
Homologene: 48253
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Brf2
Name: BRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms: 2700059M06Rik, BRFU, TFIIIB50, 5730512K07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66653
Homologene: 10127
Rnf103
Name: ring finger protein 103
Synonyms: kf-1, Zfp103
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22644
Homologene: 4146
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, PTPsigma, RPTPsigma, Ptpt9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Elavl1
Name: ELAV like RNA binding protein 1
Synonyms: Hua, 2410055N02Rik, W91709, HuR, ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15568
HGNC: HGNC:3312
Homologene: 20367
Reck
Name: reversion-inducing-cysteine-rich protein with kazal motifs
Synonyms: St15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53614
Homologene: 9622
Pla2g7
Name: phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Synonyms: PAF acetylhydrolase, PAF-AH
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27226
HGNC: HGNC:9040
Homologene: 3725
Mns1
Name: meiosis-specific nuclear structural protein 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17427
Homologene: 40628
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11982
Homologene: 56461
Myo16
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Vwa7
Name: von Willebrand factor A domain containing 7
Synonyms: G7c, D17H6S56E-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27762
Homologene: 11895
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Slc38a4
Name: solute carrier family 38, member 4
Synonyms: Ata3, 1700012A18Rik, 1110012E16Rik, SNAT4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69354
VEGA: 15
Homologene: 75077
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Synonyms: Kiaa0319
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210108
Homologene: 8878
Krt34
Name: keratin 34
Synonyms: 4733401E01Rik, Krt1-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16672
HGNC: HGNC:6452
Homologene: 31083
Gucy2d
Name: guanylate cyclase 2d
Synonyms: guanylyl cyclase D
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14918
Homologene: 71540
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Tm7sf2
Name: transmembrane 7 superfamily member 2
Synonyms: ANG1, 3110041O18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73166
Homologene: 68305
Map3k10
Name: mitogen-activated protein kinase kinase kinase 10
Synonyms: Mlk2, serine/threonine kinase, MKN28 derived nonreceptor_type, mixed lineage kinase 2, MKN28 kinase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269881
HGNC: HGNC:6849
Homologene: 1834
Syde2
Name: synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
Synonyms: C430017H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214804
Homologene: 19035
Slc7a4
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224022
Homologene: 20883
Corin
Name: corin, serine peptidase
Synonyms: Lrp4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53419
Homologene: 4804
Pfkfb4
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270198
HGNC: HGNC:8875
Homologene: 48288
Mgarp
Name: mitochondria localized glutamic acid rich protein
Synonyms: Osap, 4930583H14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67749
Homologene: 49858
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234857
Homologene: 72212
Tmcc2
Name: transmembrane and coiled-coil domains 2
Synonyms: 1110063G11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68875
Homologene: 8905
Wbp2nl
Name: WBP2 N-terminal like
Synonyms: 4930521I23Rik, PAWP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74716
VEGA: 15
Homologene: 17633
Hars2
Name: histidyl-tRNA synthetase 2
Synonyms: HARSR, HO3, 4631412B19Rik, Harsl
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70791
HGNC: HGNC:4817
Homologene: 40819
Nags
Name: N-acetylglutamate synthase
Synonyms: 1700120E20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217214
Homologene: 77363
Pidd1
Name: p53 induced death domain protein 1
Synonyms: 1200011D09Rik, Pidd, Lrdd
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57913
Homologene: 11220
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Tmtc4
Name: transmembrane and tetratricopeptide repeat containing 4
Synonyms: 5730419O14Rik, 4930403J22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70551
Homologene: 32796
Acsm2
Name: acyl-CoA synthetase medium-chain family member 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233799
Homologene: 70404
Inf2
Name: inverted formin, FH2 and WH2 domain containing
Synonyms: EG629699, 2610204M08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70435
VEGA: 12
Homologene: 82406
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Nicol1
Name: NELL2 interacting cell ontogeny regulator 1
Synonyms: LOC381633, Gm1673
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381633
Homologene: 134513
Rbfox1
Name: RNA binding protein, fox-1 homolog (C. elegans) 1
Synonyms: A2bp, HRNBP1, FOX1, A2bp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268859
VEGA: 16
Homologene: 69339
2700062C07Rik
Name: RIKEN cDNA 2700062C07 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68046
VEGA: 18
Homologene: 12230
Gsto2
Name: glutathione S-transferase omega 2
Synonyms: 4930425C18Rik, 1700020F09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68214
Homologene: 57057
Or2b28
Name: olfactory receptor family 2 subfamily B member 28
Synonyms: GA_x6K02T2QHY8-11899770-11898820, MOR256-65, MOR256-16, Olfr1367
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258526
Vmn1r224
Name: vomeronasal 1 receptor 224
Synonyms: Gm7673
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665525
Homologene: 85978
Vmn1r91
Name: vomeronasal 1 receptor 91
Synonyms: Gm8442
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667067
Homologene: 104166
Anapc15
Name: anaphase promoting complex C subunit 15
Synonyms: 6330414C15Rik, 3200002M19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75430
Homologene: 87047
Lamtor2
Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Synonyms: P14, Rab25, 2010111E04Rik, Mapbpip, Robld3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83409
Homologene: 8518
Sord
Name: sorbitol dehydrogenase
Synonyms: Sodh-1, Sdh-1, Sdh1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20322
Homologene: 56080
Kif19b
Name: kinesin family member 19B
Synonyms: Gm4869
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 101055939
Homologene: 82478
Eif4a3l2
Name: eukaryotic translation initiation factor 4A3 like 2
Synonyms: Gm5580
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434080
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 132,360,461 bp
  • T to C, chromosome 2 at 4,995,802 bp
  • T to C, chromosome 2 at 13,468,869 bp
  • T to A, chromosome 2 at 122,263,225 bp
  • T to C, chromosome 2 at 151,496,602 bp
  • G to T, chromosome 3 at 51,396,698 bp
  • C to A, chromosome 3 at 53,479,082 bp
  • T to C, chromosome 3 at 88,552,510 bp
  • T to A, chromosome 3 at 145,998,788 bp
  • G to A, chromosome 3 at 152,214,861 bp
  • A to T, chromosome 4 at 43,927,166 bp
  • T to A, chromosome 5 at 33,983,566 bp
  • T to C, chromosome 5 at 72,301,500 bp
  • T to C, chromosome 5 at 140,476,012 bp
  • A to T, chromosome 6 at 71,509,154 bp
  • A to G, chromosome 6 at 116,551,251 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC to GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC, chromosome 7 at 6,709,168 bp
  • T to C, chromosome 7 at 20,101,210 bp
  • T to C, chromosome 7 at 27,657,957 bp
  • T to C, chromosome 7 at 58,658,822 bp
  • T to C, chromosome 7 at 68,184,752 bp
  • A to G, chromosome 7 at 98,459,065 bp
  • T to G, chromosome 7 at 101,897,986 bp
  • A to T, chromosome 7 at 119,595,992 bp
  • A to G, chromosome 7 at 120,042,128 bp
  • A to G, chromosome 7 at 141,439,831 bp
  • T to C, chromosome 8 at 4,301,756 bp
  • A to G, chromosome 8 at 10,376,265 bp
  • G to A, chromosome 8 at 27,126,093 bp
  • C to A, chromosome 8 at 123,368,750 bp
  • T to C, chromosome 9 at 58,249,584 bp
  • A to T, chromosome 9 at 72,452,811 bp
  • A to T, chromosome 9 at 108,998,951 bp
  • G to A, chromosome 9 at 110,204,266 bp
  • A to T, chromosome 9 at 110,617,837 bp
  • T to C, chromosome 11 at 59,079,116 bp
  • A to T, chromosome 11 at 100,041,495 bp
  • A to T, chromosome 11 at 102,146,677 bp
  • C to T, chromosome 12 at 76,064,184 bp
  • T to A, chromosome 12 at 112,051,976 bp
  • T to C, chromosome 12 at 112,612,554 bp
  • T to A, chromosome 13 at 21,347,876 bp
  • T to G, chromosome 13 at 24,876,012 bp
  • T to C, chromosome 13 at 95,356,458 bp
  • T to C, chromosome 14 at 54,373,909 bp
  • G to A, chromosome 14 at 122,927,648 bp
  • C to T, chromosome 15 at 82,306,131 bp
  • C to T, chromosome 15 at 97,008,928 bp
  • T to A, chromosome 16 at 7,224,511 bp
  • C to T, chromosome 16 at 17,575,281 bp
  • A to T, chromosome 16 at 34,704,910 bp
  • A to T, chromosome 17 at 20,420,047 bp
  • G to A, chromosome 17 at 35,017,787 bp
  • A to T, chromosome 17 at 35,263,991 bp
  • A to G, chromosome 17 at 43,600,621 bp
  • T to A, chromosome 17 at 56,424,960 bp
  • T to A, chromosome 17 at 69,274,337 bp
  • T to C, chromosome 17 at 78,890,850 bp
  • T to C, chromosome 18 at 4,349,162 bp
  • T to C, chromosome 18 at 24,475,726 bp
  • C to A, chromosome 18 at 36,786,192 bp
  • C to T, chromosome 18 at 65,186,367 bp
  • A to G, chromosome 19 at 6,071,335 bp
  • T to A, chromosome 19 at 6,313,469 bp
  • T to C, chromosome 19 at 10,608,348 bp
  • A to T, chromosome 19 at 17,572,483 bp
  • T to A, chromosome 19 at 47,884,657 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7903 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045955-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.