Strain Name:
C57BL/6J-MtgxR7926Btlr/Mmmh
Stock Number:
045973-MU
Citation ID:
RRID:MMRRC_045973-MU
Other Names:
R7926 (G1)
Major Collection:

Strain Information

Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP7, PARP-7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Dcaf4
Name: DDB1 and CUL4 associated factor 4
Synonyms: 1110018E21Rik, Wdr21
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73828
VEGA: 12
Homologene: 9210
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Tmprss6
Name: transmembrane serine protease 6
Synonyms: matriptase-2, 1300008A22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71753
VEGA: 15
Homologene: 12408
Pdcl
Name: phosducin-like
Synonyms: 1200011E13Rik, PhLP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67466
HGNC: HGNC:8770
Homologene: 38043
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Itln1
Name: intelectin 1 (galactofuranose binding)
Synonyms: IntL, Itln2, mLfR, Itlna
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16429
Homologene: 111044
Paxip1
Name: PAX interacting (with transcription-activation domain) protein 1
Synonyms: PTIP, D5Ertd149e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 55982
HGNC: HGNC:8624
Sass6
Name: SAS-6 centriolar assembly protein
Synonyms: 2810453L12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72776
Homologene: 45668
Usp54
Name: ubiquitin specific peptidase 54
Synonyms: 4930429G18Rik, C030002J06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78787
Homologene: 90902
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Hoxa13
Name: homeobox A13
Synonyms: Hox-1.10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15398
HGNC: HGNC:5102
Homologene: 73882
Fgf10
Name: fibroblast growth factor 10
Synonyms: FGF-10, AEY17, Gsfaey17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14165
HGNC: HGNC:3666
Homologene: 3284
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Nfatc1
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
Synonyms: NFAT2, NFATc, NF-ATc, 2210017P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18018
VEGA: 18
HGNC: HGNC:7775
Homologene: 32336
BC016579
Name: cDNA sequence, BC016579
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212998
VEGA: 16
Homologene: 11622
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Png-1, Nztf1, Pmng1, C630034G21Rik, 2900093J19Rik, 2900046C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Fam76a
Name: family with sequence similarity 76, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230789
Homologene: 27071
Lmntd2
Name: lamin tail domain containing 2
Synonyms: 1600016N20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72000
Homologene: 104159
Cnih3
Name: cornichon family AMPA receptor auxiliary protein 3
Synonyms: 2900075G08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72978
Homologene: 12486
Jkamp
Name: JNK1/MAPK8-associated membrane protein
Synonyms: 1200003C05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104771
Homologene: 9524
Pacs2
Name: phosphofurin acidic cluster sorting protein 2
Synonyms: 6720425G15Rik, Pacs1l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217893
VEGA: 12
Homologene: 15016
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2510025K24Rik, 2810422M04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66573
VEGA: 14
Homologene: 45708
Six1
Name: sine oculis-related homeobox 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20471
Homologene: 4360
Tm2d2
Name: TM2 domain containing 2
Synonyms: 2410018G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69742
Homologene: 12328
Map3k3
Name: mitogen-activated protein kinase kinase kinase 3
Synonyms: MAPKKK3, Mekk3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26406
HGNC: HGNC:6855
Homologene: 69110
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
Rftn1
Name: raftlin lipid raft linker 1
Synonyms: 2310015N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76438
Homologene: 18745
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Cnn2
Name: calponin 2
Synonyms: h2-calponin, Calpo2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12798
HGNC: HGNC:2156
Homologene: 3215
Tagap
Name: T cell activation Rho GTPase activating protein
Synonyms: tcs-1, Tcd-1, tcs1, TRD, Tcd1, Tcd1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72536
Homologene: 44943
Lmf2
Name: lipase maturation factor 2
Synonyms: Tmem153, Tmem112b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105847
VEGA: 15
Homologene: 11251
Qsox1
Name: quiescin Q6 sulfhydryl oxidase 1
Synonyms: 1300003H02Rik, Qscn6, QSOX, b2b2673Clo
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 104009
HGNC: HGNC:9756
Homologene: 37690
Vmn2r125
Name: vomeronasal 2, receptor 125
Synonyms: Gm20782
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 670059
VEGA: 4
Tslp
Name: thymic stromal lymphopoietin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53603
VEGA: 18
Homologene: 81957
G530012D18Rik
Name: RIKEN cDNA G530012D1 gene
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 85,577,214 bp
  • C to T, chromosome 1 at 155,812,787 bp
  • G to A, chromosome 1 at 171,531,693 bp
  • A to G, chromosome 1 at 176,761,413 bp
  • T to C, chromosome 1 at 181,450,001 bp
  • G to A, chromosome 1 at 188,728,600 bp
  • C to T, chromosome 2 at 37,352,237 bp
  • A to C, chromosome 2 at 37,352,239 bp
  • T to C, chromosome 2 at 49,256,323 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • T to C, chromosome 3 at 65,553,525 bp
  • T to A, chromosome 3 at 116,628,770 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • A to G, chromosome 4 at 132,902,094 bp
  • A to G, chromosome 4 at 156,350,693 bp
  • A to G, chromosome 5 at 27,791,209 bp
  • CG to CGAG, chromosome 6 at 52,260,636 bp
  • A to G, chromosome 7 at 135,697,140 bp
  • G to T, chromosome 7 at 141,210,345 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • T to C, chromosome 8 at 25,020,464 bp
  • G to A, chromosome 8 at 40,606,884 bp
  • ACG to A, chromosome 8 at 95,745,647 bp
  • C to A, chromosome 9 at 20,907,559 bp
  • T to C, chromosome 9 at 54,428,042 bp
  • A to G, chromosome 9 at 114,617,815 bp
  • T to A, chromosome 10 at 79,993,326 bp
  • A to G, chromosome 10 at 86,776,047 bp
  • C to T, chromosome 11 at 67,278,906 bp
  • T to C, chromosome 11 at 106,145,722 bp
  • T to A, chromosome 12 at 29,811,652 bp
  • T to C, chromosome 12 at 72,094,816 bp
  • T to C, chromosome 12 at 73,043,809 bp
  • C to A, chromosome 12 at 83,533,929 bp
  • C to T, chromosome 12 at 113,060,752 bp
  • T to C, chromosome 13 at 118,789,216 bp
  • A to T, chromosome 14 at 20,576,968 bp
  • T to C, chromosome 14 at 118,883,499 bp
  • C to A, chromosome 15 at 78,452,850 bp
  • G to A, chromosome 15 at 89,352,421 bp
  • C to A, chromosome 16 at 45,629,462 bp
  • T to C, chromosome 17 at 7,926,938 bp
  • G to T, chromosome 17 at 50,047,380 bp
  • A to G, chromosome 18 at 32,817,193 bp
  • T to C, chromosome 18 at 80,697,666 bp
  • T to C, chromosome 19 at 41,582,569 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7926 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045973-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.