Strain Name:
C57BL/6J-MtgxR7948Btlr/Mmmh
Stock Number:
045993-MU
Citation ID:
RRID:MMRRC_045993-MU
Other Names:
R7948 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, 1110048P06Rik, NP-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Pax6
Name: paired box 6
Synonyms: Pax-6, Dey, Dickie's small eye, 1500038E17Rik, AEY11, Gsfaey11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18508
HGNC: HGNC:8620
Homologene: 1212
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Hbegf
Name: heparin-binding EGF-like growth factor
Synonyms: HB-EGF, Hegfl, Dtr
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15200
VEGA: 18
HGNC: HGNC:3059
Homologene: 1466
Mkrn1
Name: makorin, ring finger protein, 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54484
HGNC: HGNC:7112
Homologene: 32175
Serpinb6a
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonyms: Spi3, ovalbumin, D330015H01Rik, 4930482L21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20719
HGNC: HGNC:8950
Homologene: 20956
Ubtd1
Name: ubiquitin domain containing 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226122
VEGA: 19
Homologene: 11799
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Exoc6
Name: exocyst complex component 6
Synonyms: msec15, 4833405E05Rik, Sec15, Sec15l1, hbd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107371
VEGA: 19
Homologene: 41305
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Mtrex
Name: Mtr4 exosome RNA helicase
Synonyms: 2610528A15Rik, Skiv2l2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72198
VEGA: 13
Homologene: 6257
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Ptprc
Name: protein tyrosine phosphatase receptor type C
Synonyms: T200, B220, CD45, Lyt-4, Ly-5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, 2610524E03Rik, YR-23, D1Bwg0491e, Neg, Rw1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Nrros
Name: negative regulator of reactive oxygen species
Synonyms: E430025L02Rik, Lrrc33
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224109
Homologene: 17134
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Golm1
Name: golgi membrane protein 1
Synonyms: D030064E01Rik, PSEC0257, GP73, 2310001L02Rik, Golph2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Ppp2r5c
Name: protein phosphatase 2, regulatory subunit B', gamma
Synonyms: Band 8A, 2610043M05Rik, 2700063L20Rik, D12Bwg0916e, B56/PP2A gamma
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26931
VEGA: 12
HGNC: HGNC:9311
Homologene: 128665
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
9930012K11Rik
Name: RIKEN cDNA 9930012K11 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268759
Homologene: 19540
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Ccdc125
Name: coiled-coil domain containing 125
Synonyms: 5830436D01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76041
VEGA: 13
Homologene: 27932
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Deup1
Name: deuterosome assembly protein 1
Synonyms: 4933401K09Rik, Ccdc67
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234964
Homologene: 18760
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Myom2
Name: myomesin 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Trpm8
Name: transient receptor potential cation channel, subfamily M, member 8
Synonyms: CMR1, TRPP8, Trp-p8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171382
Homologene: 23433
Prickle2
Name: prickle planar cell polarity protein 2
Synonyms: 6720451F06Rik, 6230400G14Rik, mpk2, Pk2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243548
Homologene: 17889
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Or51a39
Name: olfactory receptor family 51 subfamily A member 39
Synonyms: MTPCR33, MOR11-2, GA_x6K02T2PBJ9-5431102-5430146, Olfr33
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18332
Homologene: 81534
Ercc4
Name: excision repair cross-complementing rodent repair deficiency, complementation group 4
Synonyms: Xpf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50505
HGNC: HGNC:3436
Homologene: 3836
Fam89a
Name: family with sequence similarity 89, member A
Synonyms: 2310031A18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69627
Homologene: 18887
Gtpbp3
Name: GTP binding protein 3
Synonyms: Gtpbp3, 2410009F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70359
Homologene: 6600
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 636808
Homologene: 43974
Zfp945
Name: zinc finger protein 945
Synonyms: C730040L01Rik, A630033E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240041
Homologene: 133214
Cts3
Name: cathepsin 3
Synonyms: 1600000I23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 117066
VEGA: 13
Gal3st4
Name: galactose-3-O-sulfotransferase 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330217
Homologene: 11633
Epn1
Name: epsin 1
Synonyms: Ibp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13854
Homologene: 32172
Gatad1
Name: GATA zinc finger domain containing 1
Synonyms: 2810047M21Rik, 2310031E19Rik, B330017N08Rik, 8430439A17Rik, Odag, 9130430G15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67210
Homologene: 56916
Nmnat3
Name: nicotinamide nucleotide adenylyltransferase 3
Synonyms: PNAT3, 4933408N02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74080
Homologene: 39772
Il9r
Name: interleukin 9 receptor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16199
HGNC: HGNC:6030
Homologene: 37591
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 36,794,148 bp
  • C to T, chromosome 1 at 62,745,408 bp
  • T to A, chromosome 1 at 88,374,369 bp
  • A to G, chromosome 1 at 116,580,528 bp
  • G to A, chromosome 1 at 138,064,576 bp
  • A to G, chromosome 2 at 67,519,314 bp
  • G to T, chromosome 2 at 76,768,179 bp
  • A to G, chromosome 2 at 105,685,877 bp
  • C to A, chromosome 2 at 125,341,299 bp
  • T to C, chromosome 2 at 180,202,201 bp
  • A to G, chromosome 3 at 59,331,858 bp
  • A to G, chromosome 4 at 19,528,186 bp
  • A to T, chromosome 4 at 98,424,310 bp
  • T to C, chromosome 5 at 3,643,540 bp
  • T to A, chromosome 5 at 14,765,166 bp
  • C to T, chromosome 5 at 138,271,000 bp
  • T to A, chromosome 6 at 39,400,410 bp
  • T to C, chromosome 6 at 92,416,922 bp
  • T to A, chromosome 7 at 5,089,993 bp
  • T to A, chromosome 7 at 6,708,782 bp
  • T to A, chromosome 7 at 55,794,248 bp
  • C to T, chromosome 7 at 98,075,029 bp
  • C to T, chromosome 7 at 102,713,688 bp
  • A to G, chromosome 8 at 15,085,306 bp
  • A to G, chromosome 8 at 71,492,586 bp
  • T to C, chromosome 8 at 124,751,670 bp
  • T to C, chromosome 9 at 15,610,648 bp
  • A to T, chromosome 9 at 18,642,490 bp
  • A to G, chromosome 9 at 98,399,482 bp
  • T to A, chromosome 10 at 103,404,295 bp
  • G to A, chromosome 10 at 128,125,325 bp
  • A to C, chromosome 11 at 32,194,486 bp
  • A to T, chromosome 11 at 110,050,979 bp
  • T to A, chromosome 12 at 110,465,986 bp
  • T to A, chromosome 13 at 13,746,589 bp
  • G to A, chromosome 13 at 33,923,020 bp
  • C to A, chromosome 13 at 59,664,197 bp
  • T to C, chromosome 13 at 61,566,049 bp
  • C to A, chromosome 13 at 81,559,529 bp
  • T to C, chromosome 13 at 81,559,588 bp
  • A to G, chromosome 13 at 100,696,402 bp
  • C to T, chromosome 13 at 112,921,762 bp
  • CGGTCTAGCTGAGCAGGAGGCAGCTCAGG to CGG, chromosome 14 at 70,157,366 bp
  • C to T, chromosome 15 at 64,815,350 bp
  • A to G, chromosome 16 at 13,130,185 bp
  • A to T, chromosome 16 at 32,162,258 bp
  • A to T, chromosome 17 at 22,852,122 bp
  • A to G, chromosome 18 at 36,506,699 bp
  • T to C, chromosome 18 at 82,624,415 bp
  • A to C, chromosome 19 at 37,576,974 bp
  • T to A, chromosome 19 at 42,033,735 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7948 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045993-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.