Strain Name:
C57BL/6J-MtgxR8011Btlr/Mmmh
Stock Number:
046051-MU
Citation ID:
RRID:MMRRC_046051-MU
Other Names:
R8011 (G1)
Major Collection:

Strain Information

Pou2f1
Name: POU domain, class 2, transcription factor 1
Synonyms: Oct-1C, Oct-1B, Oct-1A, oct-1, Otf-1, Otf1, 2810482H01Rik, Oct-1z, Oct1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18986
HGNC: HGNC:9212
Homologene: 37658
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Gpr6
Name: G protein-coupled receptor 6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140741
VEGA: 10
HGNC: HGNC:4515
Homologene: 38026
Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Mok
Name: MOK protein kinase
Synonyms: MOK, MAPK/MAK/MRK/ overlapping kinase, Rage, Stk30
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26448
HGNC: HGNC:9833
Homologene: 8062
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Fgr
Name: FGR proto-oncogene, Src family tyrosine kinase
Synonyms: Ali18, Mhdaali18
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14191
HGNC: HGNC:3697
Homologene: 3842
Pdk1
Name: pyruvate dehydrogenase kinase, isoenzyme 1
Synonyms: D530020C15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228026
HGNC: HGNC:8809
Homologene: 134437
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64898
Homologene: 8769
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Ankrd27
Name: ankyrin repeat domain 27
Synonyms: D330003H11Rik, Varp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245886
Homologene: 12956
Zfp626
Name: zinc finger protein 626
Synonyms: 4933426I21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71163
Tpd52l1
Name: tumor protein D52-like 1
Synonyms: D53
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21987
VEGA: 10
Homologene: 2468
Rnf13
Name: ring finger protein 13
Synonyms: Rzf, 2010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24017
Homologene: 13493
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: P130, NOPP140, 3230402K17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70769
VEGA: 19
Smco2
Name: single-pass membrane protein with coiled-coil domains 2
Synonyms: 1700023A16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69371
Homologene: 106211
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Cntn3
Name: contactin 3
Synonyms: Pang
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18488
HGNC: HGNC:2173
Homologene: 7461
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242259
Homologene: 72094
Or5j1
Name: olfactory receptor family 5 subfamily J member 1
Synonyms: GA_x6K02T2Q125-48541463-48540525, MOR172-8_p, MOR172-6, Olfr1106
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258747
Homologene: 27251
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268780
Homologene: 65044
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Cacna1e
Name: calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms: Cav2.3, Cchra1, alpha1E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12290
HGNC: HGNC:1392
Homologene: 20185
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Zfp1004
Name: zinc finger protein 1004
Synonyms: Gm14139
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100271882
Homologene: 134546
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Edc3
Name: enhancer of mRNA decapping 3
Synonyms: Yjdc, Lsm16
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 353190
Homologene: 11827
Rgs6
Name: regulator of G-protein signaling 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 50779
Homologene: 68385
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Vmn2r20
Name: vomeronasal 2, receptor 20
Synonyms: EG667180
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667180
Homologene: 84037
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1, Pyk1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Xkr5
Name: X-linked Kx blood group related 5
Synonyms: 5430438H03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319581
Homologene: 52219
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Or4c103
Name: olfactory receptor family 4 subfamily C member 103
Synonyms: GA_x6K02T2Q125-50163514-50162588, MOR230-12_p, MOR230-4, Olfr1195
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258748
Homologene: 103782
Ssx2ip
Name: SSX family member 2 interacting protein
Synonyms: Adip
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99167
Homologene: 8522
Serpinb7
Name: serine (or cysteine) peptidase inhibitor, clade B, member 7
Synonyms: 4631416M05Rik, megsin, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116872
Homologene: 68363
Or6b2b
Name: olfactory receptor family 6 subfamily B member 2B
Synonyms: GA_x6K02T2R7CC-81266841-81267776, MOR103-12, Olfr1415
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258228
Homologene: 79367
Acss2
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, AceCS1, ACAS, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Try5
Name: trypsin 5
Synonyms: Tc, 1810049H19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 103964
Homologene: 106639
Six2
Name: sine oculis-related homeobox 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20472
Homologene: 56518
Hes3
Name: hes family bHLH transcription factor 3
Synonyms: bHLHb43
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15207
Homologene: 7358
2010315B03Rik
Name: RIKEN cDNA 2010315B03 gene
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 630836
Homologene: 136499
Or2ah1
Name: olfactory receptor family 2 subfamily AH member 1
Synonyms: GA_x6K02T2Q125-47301584-47302519, MOR260-5, Olfr1018
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258579
Homologene: 27216
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 92,491,275 bp
  • T to A, chromosome 1 at 107,434,757 bp
  • A to G, chromosome 1 at 133,263,806 bp
  • T to C, chromosome 1 at 154,465,822 bp
  • A to G, chromosome 1 at 165,894,903 bp
  • G to A, chromosome 2 at 27,980,521 bp
  • A to T, chromosome 2 at 71,875,452 bp
  • T to G, chromosome 2 at 85,823,613 bp
  • A to C, chromosome 2 at 87,048,846 bp
  • G to A, chromosome 2 at 88,683,193 bp
  • A to G, chromosome 2 at 150,192,346 bp
  • T to C, chromosome 2 at 155,555,957 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to G, chromosome 3 at 57,807,070 bp
  • T to C, chromosome 3 at 146,422,911 bp
  • A to G, chromosome 3 at 154,247,810 bp
  • T to C, chromosome 4 at 132,998,479 bp
  • T to C, chromosome 4 at 152,287,481 bp
  • A to G, chromosome 5 at 25,351,234 bp
  • G to C, chromosome 6 at 18,426,093 bp
  • T to C, chromosome 6 at 41,313,487 bp
  • A to T, chromosome 6 at 102,437,899 bp
  • A to G, chromosome 6 at 123,396,410 bp
  • A to G, chromosome 6 at 146,868,135 bp
  • T to A, chromosome 7 at 27,818,715 bp
  • T to C, chromosome 7 at 35,616,881 bp
  • G to A, chromosome 7 at 75,730,465 bp
  • T to A, chromosome 7 at 139,910,620 bp
  • G to T, chromosome 8 at 18,948,720 bp
  • T to C, chromosome 8 at 110,583,909 bp
  • C to A, chromosome 9 at 57,713,376 bp
  • C to T, chromosome 9 at 124,293,899 bp
  • T to C, chromosome 10 at 31,332,917 bp
  • T to A, chromosome 10 at 41,070,915 bp
  • G to T, chromosome 11 at 21,275,095 bp
  • C to T, chromosome 11 at 119,272,936 bp
  • A to G, chromosome 12 at 83,116,292 bp
  • T to C, chromosome 12 at 110,814,917 bp
  • A to T, chromosome 13 at 11,588,140 bp
  • A to T, chromosome 15 at 7,247,044 bp
  • A to T, chromosome 16 at 22,076,099 bp
  • C to T, chromosome 16 at 32,668,365 bp
  • G to A, chromosome 16 at 35,856,634 bp
  • T to C, chromosome 17 at 3,448,396 bp
  • G to A, chromosome 17 at 71,230,375 bp
  • T to C, chromosome 17 at 85,687,672 bp
  • T to C, chromosome 19 at 46,081,584 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8011 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046051-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.