Strain Name:
B6J.Cg-Tg(Myh6-mCherry,-Trpv4)1Td/Mmmh
Stock Number:
046317-MU
Citation ID:
RRID:MMRRC_046317-MU
Other Names:
Cardiac TRPV4 Overexpressor

Strain Information

Trpv4
Name: transient receptor potential cation channel, subfamily V, member 4
Synonyms: VR-OAC, Trp12, 0610033B08Rik, OTRPC4, VROAC, VRL-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 63873
Homologene: 11003
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
mCherry
Name: red fluorescent fluorophore, mCherry
Type: Gene
Species: Discosoma sp. (mushroom coral)
Chromosome:
Genetic Alterations
Random insertion of transgene containing a-MHC-loxP(mCherrySTOP)-loxP-TRPV4 construct. Exhibits cardiomyocyte expression of the mCherry fluorescent reporter; cre-mediated recombination results in excision of the mCherry (with STOP) sequence and subsequent cardiomyocyte expression of the Trpv4 ion channel.
Genotype Determination
Phenotype
Elevated expression of Trpv4 in cardiomyocytes in young mice with potential for an inducible phenotype.
Strain Development
The Tg(alpha-MHC-loxP-mCherrySTOP-loxP-TRPV4)1td transgenic construct was created using cDNA of mouse Trpv4, the pmCherryC1 vector, the pJFRC172 vector, and the vector containing the alpha-myosin heavy chain promoter. First, pmCherryC1 was digested using BglII-BamHI for removal of the multiple cloning site, followed by AgeI-MluI (with Klenow fragment) to excise the mCherry coding region and stop codons. The mCherrySTOP sequence was then subcloned into pJFRC172 (AgeI -SpeI with Klenow fragment) resulting in a floxed mCherrySTOP sequence. The loxP-mCherrySTOP-loxP coding sequence was amplified with PCR primers encoding SalI (forward) and MluI and SalI (reverse) restriction sites, and subcloned into the SalI site of the alpha-MHC vector to form alpha-MHC-loxP-mCherrySTOP-loxP. The Trpv4 coding sequence was then amplified from cDNA with forward and reverse primers encoding BssHII restriction sites, and was inserted into the MluI site of alpha-MHC-loxP-mCherrySTOP-loxP to form alpha-MHC-loxP-mCherrySTOP-loxP-TRPV4. The resulting ~10kb transgene was excised with BamHI, purified, and injected into one-cell mouse embryos for random insertion. Resulting pups were genotyped to confirm the presence of the transgene (Forward primer: 5’–GACGGCGAGTTCATCTACAAG–3’, Reverse primer: 5’–TTCCACGATGGTGTAGTCCTC–3’), and backcrossed to C57BL/6 mice for 9 generations.
Suggested Control Mice
wild-type and C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
  • Cardiovascular
Donor
Tim Domeier, Ph.D University of Missouri - Columbia
Primary Reference

Jones JL, Peana D, Veteto AB, Lambert MD, Nourian Z, Karasseva NG, Hill MA,Lindman BR, Baines CP, Krenz M, Domeier TL. TRPV4 increases cardiomyocyte calciumcycling and contractility yet contributes to damage in the aged heart followinghypoosmotic stress. Cardiovasc Res. 2018 Jun 20. doi: 10.1093/cvr/cvy156. [Epubahead of print] (Medline PMID: 29931225)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
Eye
Black
Generation
N9 (C57BL6/J)
Overall Breeding Performance
Good
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: 8 to 12 months Greater than 12 months
Average litter size
7-9
Recommended wean age
3 Weeks
Average Pups Weaned
5-9

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046317-MU-SPERM Cryo-preserved spermatozoa $437.00 / Non-Profit Aliquot Approximate quantity3
046317-MU-RESUS Litter recovered from cryo-archive $2,624.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.