Strain Name:
B6J.129S4-Slc1a2tm1.1Pros/Mmnc
Stock Number:
050600-UNC
Citation ID:
RRID:MMRRC_050600-UNC
Other Names:
conditional GLT-1 knockout

Strain Information

Slc1a2tm1.1Pros
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2; targeted mutation 1.1, Paul A Rosenberg
Synonyms: GLT-1flox
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Conditional
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: Conditional
NCBI: 20511
Homologene: 3075
Genetic Alterations
Conditional knockout of the Slc1a2 gene by floxing exon 4. A 12.2-kb fragment (Chr2:102,731,514 –102,743,743; see Genome Data Viewer based on GRCm38) of the mouse Slc1a2 gene, containing exons 2, 3, and 4, was subcloned by recombineering from the bacterial artificial chromosome, RP23-361H22 (CHORI BACPAC Resource Center), into a plasmid containing a thymidine kinase (TK) selection cassette. A loxP site was inserted 217 bp (Chr2:102,739,471) upstream of exon 4 (Chr2: 102,739,689 –102,739,939). A neomycin (neo) selection cassette flanked by FRT sites and a single downstream loxP site was inserted 419 bp (Chr2: 102,740,358 –102,740,394) downstream of exon 4 to generate the final targeting construct.
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • ES Cell Line
    J1
    Phenotype
    Transcriptional changes similar to Huntington's disease have been described in PMID:29709465. Unpublished results have revealed behavioral and electrophysiological phenotypes. Conditional phenotypes have been found for the knockout of Slc1a2 in neurons, in astrocytes, and in oligodendrocytes. Not all of these findings have been published.
    MeSH Terms
    • Animals
    • Astrocytes/metabolism
    • Astrocytes/ultrastructure
    • Body Weight
    • Brain/cytology
    • Brain/metabolism
    • Brain/ultrastructure
    • Electroencephalography
    • Epilepsy/metabolism
    • Epilepsy/mortality
    • Epilepsy/prevention & control
    • Excitatory Amino Acid Transporter 2/genetics
    • Excitatory Amino Acid Transporter 2/metabolism
    • Female
    • Glutamic Acid/metabolism
    • Liposomes/metabolism
    • Male
    • Mice
    • Mice, Knockout
    • Neurons/metabolism
    • Neurons/ultrastructure
    • Presynaptic Terminals/metabolism
    • Synaptosomes/metabolism
    Strain Development
    The construct was linearized with SalI and electroporated into J1 ES cells (PMID:1606615) from 129S4/SvJae mice and subsequently selected with appropriate drugs. Genomic DNA from resistant colonies was screened by long-range PCR (KOD Extreme Hot Start DNA Polymerase, EMD Millipore) for homologous recombination. Left-arm primers (PLF: GACTAGCATTCTCTGGGGTGCAGCTTGGGAGTTGC, LoxPR: TTA AGGGTTATTGAATATGATCGGAATTGGGCTGCAGGAATT) amplify a 7.9 kb fragment after homologous recombination. Right arm primers (NeoF: TGGGGCAGGACAGCAAGGGGGAGGAT; PRR: GTGGTATTGGCCTCCTCAGATGGAGGTGCCACCA) amplify a 3.3-kb fragment after homologous recombination. Clones indicating appropriate homologous recombination were subjected to karyotype analysis and clones with a high number of cells with 40 chromosomes were injected into C57BL/6 blastocysts. Chimeric animals were mated and offspring were assessed for germline transmission of the targeted allele. In some cases, clones were subjected to a second round of transfection with the pOG231 plasmid (courtesy of Stephen O’Gorman, Case Western Reserve University, Cleveland, Ohio) that contains a gene encoding a Cre-NLS protein driven by a CMV promoter. Subsequent subclones were analyzed by genotyping for those that underwent the appropriate recombination of loxP sites. Even though the neomycin resistance cassette resided in an intron, it had unpredictable effects on the expression of the gene of interest and other nearby genes. The neomycin cassette was, therefore, removed in vivo by mating mice homozygous for the conditional Slc1a2 knock-out allele with mice expressing the FLP1 recombinase gene driven by the Gt(ROSA)26Sor promoter (129S4/SvJaeSor-Gt(ROSA)26Sortm1(FLP1)Dym/J - JAX Strain #003946). Subsequent backcrossing (N10) to C57BL/6J and sib-mating (F2).
    Suggested Control Mice
    C57BL/6J, however, when using Cre-recombinase, it is necessary that appropriate controls for the specific Cre vector be incorporated into the experiments.
    MMRRC Genetic QC Summary
    The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.
    • Cell Biology
    • Metabolism
    • Models for Human Disease
    • Neurobiology
    • Research Tools
    • Sensorineural
    Donor
    Paul Rosenberg, Ph.D., Boston Children's Hospital
    Primary Reference

    Petr GT, Sun Y, Frederick NM, Zhou Y, Dhamne SC, Hameed MQ, Miranda C, Bedoya EA, Fischer KD, Armsen W, Wang J, Danbolt NC, Rotenberg A, Aoki CJ, Rosenberg PA. Conditional deletion of the glutamate transporter GLT-1 reveals that astrocytic GLT-1 protects against fatal epilepsy while neuronal GLT-1 contributes significantly to glutamate uptake into synaptosomes. J Neurosci. 2015 Apr 1;35(13):5187-201. doi: 10.1523/JNEUROSCI.4255-14.2015. (Medline PMID: 25834045)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    Eye
    Black
    MMRRC Breeding System
    Sib-mating
    Generation
    N10 (C57BL/6J), F2
    Overall Breeding Performance
    Excellent
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: 6 to 8 months 8 to 12 months
    Average litter size
    7-9
    Recommended wean age
    3 Weeks
    Average Pups Weaned
    5-9

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    050600-UNC-EMBRYO Cryo-preserved embryos $1,404.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
    050600-UNC-SPERM Cryo-preserved spermatozoa $564.00 / Non-Profit Aliquot Approximate quantity3
    050600-UNC-RESUS Litter recovered from cryo-archive $2,914.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.