Strain Name:
C57BL/6J-Cyp2b10em1(Del(7Cyp2b10-Cyp2b9))Fatso/Mmnc
Stock Number:
050703-UNC
Citation ID:
RRID:MMRRC_050703-UNC
Other Names:
Cyp2b9/10/13-null

Strain Information

Cyp2b10em1(Del(7Cyp2b10-Cyp2b9))Fatso
Name: cytochrome P450, family 2, subfamily b, polypeptide 10; endonuclease-mediated mutation 1, William Baldwin
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 7
Cyp2b9
Name: cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms: Cyp2b, phenobarbitol inducible, type a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13094
HGNC: HGNC:2615
Homologene: 74933
Cyp2b13
Name: cytochrome P450, family 2, subfamily b, polypeptide 13
Synonyms: phenobarbital inducible, type c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13089
HGNC: HGNC:2615
Homologene: 74933
Cyp2b10
Name: cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms: p16, Cyp2b, phenobarbitol inducible, type b, Cyp2b20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13088
HGNC: HGNC:2615
Homologene: 73894
Genetic Alterations
CRISPR/Cas9 was used to delete a chromosomal region containing Cyp2b9, Cyp2b10, and Cyp2b13. The triple knockout does not contain any of these primarily hepatic Cyp2b members.

  • Cyp2b10 - cytochrome P450, family 2, subfamily b, polypeptide 10 (MGI:88598)
  • Cyp2b9 - cytochrome P450, family 2, subfamily b, polypeptide 9 (MGI:88600)
  • Cyp2b13 - cytochrome P450, family 2, subfamily b, polypeptide 13 (MGI:88599)
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • Phenotype
    The Cyp2b members are crucial in the metabolism of several pharmaceuticals and toxicants. While the differential metabolism has not been investigated by the strain's donor, it is suspected that that several chemicals such as efavirenz and parathion are differentially metabolized. A "knockdown" mouse made earlier was more sensitive to parathion and zoxazolamine.

    The mice are diet-induced obese. At the time of donation, the donor examined whether (and why) the animals are more susceptible to non-alcoholic fatty liver disease (NAFLD). Manuscript on diet-induced obesity was submitted to J Nutr Biochem.
    MeSH Terms
    • Animals
    • Aryl Hydrocarbon Hydroxylases/genetics
    • Aryl Hydrocarbon Hydroxylases/metabolism
    • CRISPR-Cas Systems
    • Cytochrome P-450 Enzyme System/genetics
    • Cytochrome P-450 Enzyme System/metabolism
    • Cytochrome P450 Family 2/genetics
    • Cytochrome P450 Family 2/metabolism
    • Female
    • Gene Deletion
    • Gene Expression
    • Mice
    • Mice, Inbred C57BL
    • Mice, Knockout
    • Pharmacological and Toxicological Phenomena
    • Receptors, Cytoplasmic and Nuclear/genetics
    • Receptors, Cytoplasmic and Nuclear/metabolism
    • Steroid Hydroxylases/genetics
    • Steroid Hydroxylases/metabolism
    Strain Development
    Cyp2b9/10/13-null mice were produced using the CRISPR/Cas9 system. Cyp2b9, Cyp2b10, and Cyp2b13 are the three Cyp2b members primarily expressed in the liver and found in a tandem repeat.

    1. Each of the three hepatic genes was targeted. Cas9 mRNA from Streptococcuspyogenes and a 20-nt guide sequence that was specific to the target site with an 83-nt scaffold sequence, which was common to all the sgRNAs was injected into the cytoplasm of the mouse blastocyst (C57BL/6).
    2. The scaffold sequence was guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.
      The Cyp2b10 guide sequence was: uguggaggagcggauucagg(AGG).
      The Cyp2b13 guide sequence was: (CCC)ugcaagagguuccccaagag.
      The Cyp2b9 guide sequence was: acattgatacctaccttctg(AGG).
      The protospacer adjacent motif (PAM) is shown in parentheses.
    3. The incorporation efficiency at each site in vitro was Cyp2b10, 47.6%, Cyp2b13, 33.3%, and Cyp2b9, 33.3%.
    4. The resultant injection of more than 100 embryos produced two mice with a 287-kB deletion lacking all three hepatic Cyp2b members found in a tandem repeat.
    5. Corresponding WT controls (C57BL/6J) were obtained from The Jackson Laboratory (Bar Harbor, ME) and used to produce the Cyp2b9/10/13-null mice and to demonstrate germline transmission.
    6. Mating of heterozygotes produced a small proportion of homozygotes null for Cyp2b9/10/13 as determined by genotyping (see protocol).
    Suggested Control Mice
    C57BL/6J or humanized CYP2B6 mice (another strain we developed from breeding with a collaborator's transgenic line.
    MMRRC Genetic QC Summary
    The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.
    • Metabolism
    • Obesity
    Donor
    William Baldwin, Ph.D., Clemson University.
    Primary Reference

    Kumar R, Mota LC, Litoff EJ, Rooney JP, Boswell WT, Courter E, Henderson CM,Hernandez JP, Corton JC, Moore DD, Baldwin WS. Compensatory changes in CYPexpression in three different toxicology mouse models: CAR-null, Cyp3a-null, and Cyp2b9/10/13-null mice. PLoS One. 2017 Mar 28;12(3):e0174355. doi:10.1371/journal.pone.0174355. eCollection 2017. (Medline PMID: 28350814)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    Eye
    Black
    MMRRC Breeding System
    Random intra-strain mating
    Generation
    N3-4 (C57BL/6J)
    Overall Breeding Performance
    Good
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: 8 to 12 months Greater than 12 months
    Bred to Homozygosity
    Yes
    Average litter size
    4-6
    Recommended wean age
    3 Weeks
    Average Pups Weaned
    4-6

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    050703-UNC-EMBRYO Cryo-preserved embryos $1,404.00 / $2,331.00
    Non-Profit / For-Profit
    Aliquot Approximate quantity2 : 20-40 embryos / aliquot
    050703-UNC-SPERM Cryo-preserved spermatozoa $564.00 / $937.00
    Non-Profit / For-Profit
    Aliquot Approximate quantity3
    050703-UNC-RESUS Litter recovered from cryo-archive $2,914.00 / $4,837.00
    Non-Profit / For-Profit
    Litter Recovered litter4; additional fees for any special requests.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.