Strain Name:
C57BL/6NJ-Brd3em1(IMPC)J/Mmjax
Stock Number:
065764-JAX
Citation ID:
RRID:MMRRC_065764-JAX
Major Collection:

Strain Information

Brd3em1(IMPC)J
Name: bromodomain containing 3; endonuclease-mediated mutation 1, Jackson
Type: Allele
Species: Mus musculus (mouse)
Chromosome:
Alteration at locus: CRISPR
Brd3
Name: bromodomain containing 3
Synonyms: RINGL3, ORFX, 2410084F24Rik, Fsrg2
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: CRISPR
NCBI: 67382
HGNC: HGNC:1104
Homologene: 81801
Genetic Alterations
Intragenic deletion
Genotype Determination
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain Development
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAACAGTAAAAACTTAGA and TGTTAAGAGATTTGTCATGG, which resulted in a 352 bp deletion beginning at Chromosome 2 position 27,462,338 bp and ending after 27,462,689 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283892 (exon 4) and 204 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 69 amino acids later.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Generation
N2F2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined Undetermined
Heterozygotes are fertile: Undetermined Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
065764-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
065764-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.