Strain Name:
C57BL/6J-MtgxR8068Btlr/Mmmh
Stock Number:
067503-MU
Citation ID:
RRID:MMRRC_067503-MU
Other Names:
R8068 (G1)
Major Collection:

Strain Information

Qki
Name: quaking, KH domain containing RNA binding
Synonyms: l(17)-1Wis, QkI, l17Wis1, 1110003F05Rik, Qk
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19317
VEGA: 17
Homologene: 11059
Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, 1110048P06Rik, NP-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Slc1a6
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Rnf111
Name: ring finger 111
Synonyms: Arkadia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93836
VEGA: 9
Homologene: 9741
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Drosha
Name: drosha, ribonuclease type III
Synonyms: 1110013A17Rik, Etohi2, Rnasen
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14000
Homologene: 8293
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, 2810036L13Rik, Hnrpll
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Kctd9
Name: potassium channel tetramerisation domain containing 9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105440
Homologene: 9754
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 4632407J06Rik, 2810487N22Rik, B130055D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Opa3
Name: optic atrophy 3
Synonyms: LOC243868, LOC384570, D630048P19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 403187
HGNC: HGNC:8142
Homologene: 57022
Lrrfip1
Name: leucine rich repeat (in FLII) interacting protein 1
Synonyms: FLAP (FLI LRR associated protein), Fliiap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16978
HGNC: HGNC:6702
Homologene: 48301
Itgb3
Name: integrin beta 3
Synonyms: platelet glycoprotein IIIa (GP3A), CD61
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16416
HGNC: HGNC:6156
Homologene: 55444
Nrip1
Name: nuclear receptor interacting protein 1
Synonyms: RIP140, 6030458L20Rik, 8430438I05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268903
HGNC: HGNC:8001
Homologene: 2606
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329252
Homologene: 49680
P3h1
Name: prolyl 3-hydroxylase 1
Synonyms: 2410024C15Rik, Gros1, Lepre1, Leprecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56401
Homologene: 10509
Pde4b
Name: phosphodiesterase 4B, cAMP specific
Synonyms: dunce, Dpde4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18578
HGNC: HGNC:8781
Homologene: 1953
Mns1
Name: meiosis-specific nuclear structural protein 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17427
Homologene: 40628
Atmin
Name: ATM interactor
Synonyms: Asciz, gpg6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234776
Homologene: 35321
Slc22a4
Name: solute carrier family 22 (organic cation transporter), member 4
Synonyms: Octn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30805
Homologene: 81701
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: A830008O07Rik, 1700010C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Gls2
Name: glutaminase 2 (liver, mitochondrial)
Synonyms: Lga, A330074B06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216456
Homologene: 40861
Kcna10
Name: potassium voltage-gated channel, shaker-related subfamily, member 10
Synonyms: Kv1.8, Kcna8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242151
HGNC: HGNC:6219
Homologene: 4054
Speer2
Name: spermatogenesis associated glutamate (E)-rich protein 2
Synonyms: SPEER-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224318
Homologene: 69402
Zfp53
Name: zinc finger protein 53
Synonyms: zfas8, KRAZ1, Zfp-53, Zfp118, D030067O06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24132
VEGA: 17
Homologene: 135946
Mdm1
Name: MDM1 nuclear protein
Synonyms: Mdm-1, transformed mouse 3T3 cell double minute 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17245
VEGA: 10
Homologene: 9692
Cfap251
Name: cilia and flagella associated protein 251
Synonyms: 4930415N18Rik, 4933428F06Rik, Wdr66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269701
Homologene: 16964
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Synpo2
Name: synaptopodin 2
Synonyms: myopodin, Myo, 1110069I04Rik, 9530006G20Rik, 2310068J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 118449
Homologene: 15400
Mthfs
Name: 5, 10-methenyltetrahydrofolate synthetase
Synonyms: 1110034I12Rik, 2310020H23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107885
Homologene: 4702
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Vmn1r45
Name: vomeronasal 1 receptor 45
Synonyms: V1r2, V1ra2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22297
Homologene: 130651
Dlx4
Name: distal-less homeobox 4
Synonyms: DII D, Dlx-4, Dlx7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13394
HGNC: HGNC:2917
Homologene: 7292
Or52p1
Name: olfactory receptor family 52 subfamily P member 1
Synonyms: GA_x6K02T2PBJ9-7245486-7246451, MOR27-1, Olfr656
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259078
Homologene: 128072
Ttpa
Name: tocopherol (alpha) transfer protein
Synonyms: alpha TTP, alpha-TTP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50500
Homologene: 37295
Vmn2r7
Name: vomeronasal 2, receptor 7
Synonyms: 4933425M15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319217
Homologene: 129754
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: ether a go-go, Eag1, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Or5ap2
Name: olfactory receptor family 5 subfamily AP member 2
Synonyms: GA_x6K02T2Q125-47327964-47328917, MOR201-2, Olfr1020
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258573
Homologene: 45007
Ces2e
Name: carboxylesterase 2E
Synonyms: 9030624L02Rik, Ces5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234673
HGNC: HGNC:1864
Homologene: 86210
Cd47
Name: CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms: Itgp, 9130415E20Rik, B430305P08Rik, integrin-associated protein, IAP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16423
HGNC: HGNC:1682
Homologene: 1346
Or5w19
Name: olfactory receptor family 5 subfamily W member 19
Synonyms: GA_x6K02T2Q125-49372426-49373358, MOR177-12, Olfr1152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258103
Homologene: 79357
Gatad1
Name: GATA zinc finger domain containing 1
Synonyms: 2810047M21Rik, 2310031E19Rik, B330017N08Rik, 8430439A17Rik, Odag, 9130430G15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67210
Homologene: 56916
Slc22a17
Name: solute carrier family 22 (organic cation transporter), member 17
Synonyms: 1700094C23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 59049
VEGA: 14
Homologene: 10684
Rbpjl
Name: recombination signal binding protein for immunoglobulin kappa J region-like
Synonyms: RBP-J kappa-like, RBP-L, Rbpsuhl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19668
Homologene: 7512
Scyl1
Name: SCY1-like 1 (S. cerevisiae)
Synonyms: p105, mfd, 2810011O19Rik, Ntkl, mdf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78891
VEGA: 19
Homologene: 6947
Aldoc
Name: aldolase C, fructose-bisphosphate
Synonyms: Aldolase C, zebrin II, Aldo3, Scrg2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11676
HGNC: HGNC:418
Homologene: 21073
Pcdha11
Name: protocadherin alpha 11
Synonyms: Cnr7, Crnr7, A830022B16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12942
HGNC: HGNC:8665
Homologene: 75095
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 62,745,408 bp
  • T to C, chromosome 1 at 75,422,250 bp
  • A to T, chromosome 1 at 91,128,102 bp
  • T to C, chromosome 1 at 135,063,664 bp
  • T to C, chromosome 1 at 158,935,985 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • A to G, chromosome 1 at 192,241,942 bp
  • A to G, chromosome 2 at 85,849,806 bp
  • A to G, chromosome 2 at 87,868,651 bp
  • A to G, chromosome 2 at 164,408,518 bp
  • A to T, chromosome 3 at 64,716,086 bp
  • T to C, chromosome 3 at 83,300,438 bp
  • T to G, chromosome 3 at 107,194,410 bp
  • T to A, chromosome 3 at 123,117,392 bp
  • C to A, chromosome 4 at 20,028,419 bp
  • T to C, chromosome 4 at 102,596,015 bp
  • A to G, chromosome 4 at 119,236,862 bp
  • T to C, chromosome 5 at 3,643,540 bp
  • C to A, chromosome 5 at 115,952,466 bp
  • T to C, chromosome 5 at 115,982,235 bp
  • A to G, chromosome 5 at 123,256,166 bp
  • A to T, chromosome 6 at 89,933,279 bp
  • A to G, chromosome 6 at 118,413,750 bp
  • A to G, chromosome 7 at 19,244,985 bp
  • G to T, chromosome 7 at 27,324,168 bp
  • T to A, chromosome 7 at 104,618,253 bp
  • T to A, chromosome 7 at 141,744,685 bp
  • T to A, chromosome 8 at 40,825,938 bp
  • G to T, chromosome 8 at 104,932,997 bp
  • A to G, chromosome 8 at 116,956,650 bp
  • T to C, chromosome 9 at 27,063,361 bp
  • A to T, chromosome 9 at 70,457,941 bp
  • A to C, chromosome 9 at 72,448,527 bp
  • G to A, chromosome 9 at 89,211,235 bp
  • G to C, chromosome 10 at 78,812,872 bp
  • A to G, chromosome 10 at 118,146,804 bp
  • C to G, chromosome 10 at 128,195,114 bp
  • A to C, chromosome 11 at 53,997,443 bp
  • T to C, chromosome 11 at 78,324,727 bp
  • T to C, chromosome 11 at 95,145,330 bp
  • T to A, chromosome 11 at 104,665,511 bp
  • T to A, chromosome 13 at 24,075,728 bp
  • A to T, chromosome 14 at 54,908,908 bp
  • T to A, chromosome 14 at 67,724,662 bp
  • T to A, chromosome 14 at 79,536,390 bp
  • T to A, chromosome 15 at 12,883,190 bp
  • T to C, chromosome 15 at 71,532,978 bp
  • T to A, chromosome 16 at 49,895,416 bp
  • T to C, chromosome 16 at 69,860,524 bp
  • T to A, chromosome 16 at 76,292,953 bp
  • T to C, chromosome 17 at 10,318,803 bp
  • A to T, chromosome 17 at 21,509,012 bp
  • T to C, chromosome 17 at 80,050,852 bp
  • T to A, chromosome 18 at 37,005,565 bp
  • A to G, chromosome 19 at 5,760,825 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8068 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067503-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.