Strain Name:
C57BL/6J-MtgxR8077Btlr/Mmmh
Stock Number:
067511-MU
Citation ID:
RRID:MMRRC_067511-MU
Other Names:
R8077 (G1)
Major Collection:

Strain Information

Fn1
Name: fibronectin 1
Synonyms: Fn-1, Fn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14268
HGNC: HGNC:3778
Homologene: 1533
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Ssbp4
Name: single stranded DNA binding protein 4
Synonyms: 1210002E11Rik, Ssdp4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76900
Homologene: 41881
Qtrt1
Name: queuine tRNA-ribosyltransferase catalytic subunit 1
Synonyms: Tgt, tRNA-guanine transglycosylase, 2610028E17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 60507
VEGA: 9
Homologene: 11061
Luzp1
Name: leucine zipper protein 1
Synonyms: Luzp, 2700072H04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Nup35
Name: nucleoporin 35
Synonyms: 5330402E05Rik, 2310006I24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69482
Homologene: 44517
Esyt2
Name: extended synaptotagmin-like protein 2
Synonyms: 2410017M09Rik, 4921504I16Rik, 2310058N22Rik, D12Ertd551e, Fam62b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52635
VEGA: 12
Homologene: 32699
Ccdc191
Name: coiled-coil domain containing 191
Synonyms: 2610015P09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212153
Homologene: 19484
Vti1a
Name: vesicle transport through interaction with t-SNAREs 1A
Synonyms: Vti1-rp2, 1110018K19Rik, 1110014F16Rik, 4921537J05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53611
VEGA: 19
Homologene: 39963
Dis3
Name: DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms: 2810028N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72662
VEGA: 14
Homologene: 6910
Ift80
Name: intraflagellar transport 80
Synonyms: 4921524P20Rik, Wdr56
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68259
Homologene: 12253
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Clca2
Name: chloride channel accessory 2
Synonyms: Clca5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229933
HGNC: HGNC:2016
Homologene: 4765
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Rps6
Name: ribosomal protein S6
Synonyms: S6R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20104
Homologene: 85949
Six6
Name: sine oculis-related homeobox 6
Synonyms: Six9, Optx2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20476
Homologene: 7220
Cemip
Name: cell migration inducing protein, hyaluronan binding
Synonyms: 12H19.01.T7, 6330404C01Rik, 9930013L23Rik, Hybid
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80982
Homologene: 10268
Alb
Name: albumin
Synonyms: Alb-1, Alb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11657
HGNC: HGNC:399
Homologene: 405
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Cfap97
Name: cilia and flagella associated protein 97
Synonyms: 1110068E21Rik, 4933411K20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66756
Homologene: 12026
Luc7l
Name: Luc7-like
Synonyms: 2410018D03Rik, 1810045C04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66978
HGNC: HGNC:6723
Homologene: 100558
Arhgef3
Name: Rho guanine nucleotide exchange factor 3
Synonyms: 1200004I24Rik, C76747, 9830169H03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71704
VEGA: 14
HGNC: HGNC:683
Homologene: 41329
Rrm2b
Name: ribonucleotide reductase M2 B (TP53 inducible)
Synonyms: p53R2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 382985
Homologene: 56723
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Mcoln2
Name: mucolipin 2
Synonyms: 3300002C04Rik, mucolipidin 2, TRPML2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68279
Homologene: 12258
Gbp5
Name: guanylate binding protein 5
Synonyms: 5330409J06Rik, Gbp5a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229898
Homologene: 14183
Aadacl4fm1
Name: AADACL4 family member 1
Synonyms: LOC381572, 9430007A20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381572
Homologene: 28662
Zbtb38
Name: zinc finger and BTB domain containing 38
Synonyms: A930014K01Rik, Zenon homolog, CIBZ
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245007
Homologene: 19529
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Vmn2r66
Name: vomeronasal 2, receptor 66
Synonyms: F830104D24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233437
Homologene: 115466
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Or13a17
Name: olfactory receptor family 13 subfamily A member 17
Synonyms: IB6, MOR253-2, GA_x6K02T2PBJ9-42837030-42837962, Olfr45
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18344
Homologene: 79416
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Fbxo41
Name: F-box protein 41
Synonyms: D6Ertd538e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330369
Homologene: 19837
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: UGT1.6, Ugt1a6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94284
Homologene: 85959
Atp8b3
Name: ATPase, class I, type 8B, member 3
Synonyms: SAPLT, 1700042F02Rik, 1700056N23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67331
VEGA: 10
Homologene: 19034
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Slc23a2
Name: solute carrier family 23 (nucleobase transporters), member 2
Synonyms: YSPL3, SVCT2, Slc23a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54338
Homologene: 68440
Or2o1
Name: olfactory receptor family 2 subfamily O member 1
Synonyms: GA_x6K02T2QP88-6274566-6273628, MOR280-1, Olfr1394
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258273
Homologene: 138305
Ldlrad1
Name: low density lipoprotein receptor class A domain containing 1
Synonyms: OTTMUSG00000008594
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 546840
Homologene: 54473
Tmem192
Name: transmembrane protein 192
Synonyms: 3110005G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73067
Homologene: 16751
Cln8
Name: CLN8 transmembrane ER and ERGIC protein
Synonyms: ceroid-lipofuscinosis, neuronal 8, Tlcd6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26889
HGNC: HGNC:2079
Homologene: 10340
Or6k2
Name: olfactory receptor family 6 subfamily K member 2
Synonyms: GA_x6K02T2P20D-20995211-20994246, MOR105-10, Olfr420
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258302
Homologene: 17185
Lrrc8b
Name: leucine rich repeat containing 8 family, member B
Synonyms: R75581, 2210408K08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433926
Homologene: 9103
Ifitm10
Name: interferon induced transmembrane protein 10
Synonyms: 6330512M04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320802
Prdm12
Name: PR domain containing 12
Synonyms: LOC381359
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381359
Homologene: 10999
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233230
Homologene: 115575
Klrh1
Name: killer cell lectin-like receptor subfamily H, member 1
Synonyms: LOC232415, Gm156
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232415
Homologene: 16395
Stox1
Name: storkhead box 1
Synonyms: 4732470K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216021
Homologene: 17649
1700093K21Rik
Name: RIKEN cDNA 1700093K21 gene
Synonyms: b2b3025Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67358
Homologene: 49849
Krtap5-20
Name: keratin associated protein 5-20
Synonyms: Gm4559
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043627
VEGA: 7
Rnase11
Name: ribonuclease, RNase A family, 11 (non-active)
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 497113
Homologene: 17054
4930563M21Rik
Name: RIKEN cDNA 4930563M21 gene
Synonyms: Rfpl3s
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75258
VEGA: 9
Homologene: 138467
Tle7
Name: TLE family member 7
Synonyms: Gm21964
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102638837
VEGA: 8
Homologene: 131708
Sh2d1b2
Name: SH2 domain containing 1B2
Synonyms: Eat2b, Ert, Sh2d1c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545378
Homologene: 86825
Krtap10-27
Name: keratin associated protein 10-27
Synonyms: Gm9507
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 670880
Homologene: 115744
Smbd1
Name: somatomedin B domain containing 1
Synonyms: LOC381043, LOC385630, Gm933
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 381043
Homologene: 136544
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 71,612,602 bp
  • A to T, chromosome 1 at 88,138,853 bp
  • A to T, chromosome 1 at 136,471,448 bp
  • A to G, chromosome 1 at 170,248,173 bp
  • A to G, chromosome 1 at 174,151,845 bp
  • A to G, chromosome 1 at 188,542,828 bp
  • C to T, chromosome 2 at 12,242,433 bp
  • A to G, chromosome 2 at 31,642,304 bp
  • A to G, chromosome 2 at 80,638,936 bp
  • C to A, chromosome 2 at 132,089,172 bp
  • A to G, chromosome 3 at 68,916,145 bp
  • G to A, chromosome 3 at 142,507,739 bp
  • A to G, chromosome 3 at 145,071,527 bp
  • T to C, chromosome 3 at 146,190,414 bp
  • A to G, chromosome 4 at 86,855,921 bp
  • G to A, chromosome 4 at 107,209,491 bp
  • T to G, chromosome 4 at 136,543,091 bp
  • T to C, chromosome 4 at 144,528,556 bp
  • G to C, chromosome 5 at 90,467,355 bp
  • C to A, chromosome 5 at 105,480,017 bp
  • A to T, chromosome 6 at 85,473,229 bp
  • T to C, chromosome 6 at 107,568,822 bp
  • A to G, chromosome 6 at 129,766,695 bp
  • A to T, chromosome 7 at 48,198,455 bp
  • C to A, chromosome 7 at 84,003,408 bp
  • A to T, chromosome 7 at 85,006,885 bp
  • C to T, chromosome 7 at 140,691,133 bp
  • C to T, chromosome 7 at 142,273,816 bp
  • A to T, chromosome 7 at 142,370,967 bp
  • G to T, chromosome 8 at 12,998,494 bp
  • A to T, chromosome 8 at 14,894,950 bp
  • G to T, chromosome 8 at 46,170,445 bp
  • A to G, chromosome 8 at 64,965,544 bp
  • T to C, chromosome 8 at 70,598,997 bp
  • G to A, chromosome 8 at 105,359,380 bp
  • C to T, chromosome 8 at 110,110,103 bp
  • A to T, chromosome 9 at 14,550,502 bp
  • C to T, chromosome 9 at 21,420,096 bp
  • C to T, chromosome 9 at 55,987,966 bp
  • A to T, chromosome 9 at 96,688,100 bp
  • A to G, chromosome 9 at 108,828,331 bp
  • T to C, chromosome 10 at 62,665,566 bp
  • C to A, chromosome 10 at 77,080,851 bp
  • T to A, chromosome 10 at 77,811,770 bp
  • G to A, chromosome 10 at 80,531,024 bp
  • A to T, chromosome 11 at 8,445,667 bp
  • A to T, chromosome 11 at 23,517,237 bp
  • A to G, chromosome 11 at 49,160,485 bp
  • T to A, chromosome 12 at 72,940,326 bp
  • T to A, chromosome 12 at 116,342,228 bp
  • A to T, chromosome 13 at 63,540,812 bp
  • T to C, chromosome 14 at 27,385,924 bp
  • T to C, chromosome 14 at 51,049,941 bp
  • C to T, chromosome 14 at 99,090,035 bp
  • T to A, chromosome 15 at 8,311,250 bp
  • T to C, chromosome 15 at 37,946,800 bp
  • T to C, chromosome 16 at 32,810,434 bp
  • A to G, chromosome 16 at 36,918,633 bp
  • T to C, chromosome 16 at 43,915,605 bp
  • T to C, chromosome 17 at 26,255,073 bp
  • TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG to TCAGTGGTGGTCAGG, chromosome 17 at 35,619,736 bp
  • T to G, chromosome 19 at 55,576,485 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8077 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067511-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.