Strain Name:
C57BL/6J-MtgxR8227Btlr/Mmmh
Stock Number:
067644-MU
Citation ID:
RRID:MMRRC_067644-MU
Other Names:
R8227 (G1)
Major Collection:

Strain Information

Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Snx6
Name: sorting nexin 6
Synonyms: 2610032J07Rik, 2010006G21Rik, 2810425K19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72183
VEGA: 12
Homologene: 12304
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Lepr
Name: leptin receptor
Synonyms: Obr, leptin receptor gene-related protein, OB-RGRP, LEPROT, obl, obese-like, Modb1, Leprb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Csnk1g2
Name: casein kinase 1, gamma 2
Synonyms: 2810429I12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103236
VEGA: 10
HGNC: HGNC:2455
Homologene: 100845
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: mGluR3, 0710001G23Rik, Gprc1c, mGlu3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Slc7a14
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241919
Homologene: 76320
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224079
Homologene: 75330
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Rps16
Name: ribosomal protein S16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20055
Homologene: 794
Acp7
Name: acid phosphatase 7, tartrate resistant
Synonyms: C330005M16Rik, Papl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101744
Homologene: 23924
Pdss2
Name: prenyl (solanesyl) diphosphate synthase, subunit 2
Synonyms: 5430420P03Rik, mDLP1, PLMP, kd
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71365
Homologene: 56885
Arhgap24
Name: Rho GTPase activating protein 24
Synonyms: 0610025G21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231532
Homologene: 32754
Rpusd4
Name: RNA pseudouridylate synthase domain containing 4
Synonyms: 2410001E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71989
Homologene: 32794
Gm4781
Name: predicted gene 4781
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213051
VEGA: 10
Dusp13b
Name: dual specificity phosphatase 13B
Synonyms: TMDP, LMW-DSP6, TS-DSP6, LOC382853, Dusp13
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27389
Homologene: 121602
Gm1968
Name: predicted gene 1968
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328657
VEGA: 16
Gm7276
Name: predicted gene 7276
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108168393
VEGA: 18
Fam179a
Name:
Type: Gene
Species: Mouse
Chromosome: 17
Foxr1
Name: forkhead box R1
Synonyms: LOC382074, Foxn5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382074
VEGA: 9
Homologene: 19844
Mup14
Name: major urinary protein 14
Synonyms: Gm13514
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039116
Homologene: 74304
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 153,223,754 bp
  • T to C, chromosome 3 at 31,209,212 bp
  • C to T, chromosome 4 at 61,302,495 bp
  • T to C, chromosome 4 at 101,771,362 bp
  • T to C, chromosome 5 at 9,570,242 bp
  • A to G, chromosome 5 at 102,875,781 bp
  • T to A, chromosome 7 at 28,352,501 bp
  • C to A, chromosome 7 at 28,616,648 bp
  • A to G, chromosome 8 at 36,572,671 bp
  • T to C, chromosome 9 at 35,268,535 bp
  • T to C, chromosome 9 at 44,436,007 bp
  • A to T, chromosome 10 at 43,345,581 bp
  • G to A, chromosome 10 at 80,638,629 bp
  • G to A, chromosome 10 at 100,396,562 bp
  • A to T, chromosome 12 at 54,751,971 bp
  • A to G, chromosome 14 at 21,742,801 bp
  • A to G, chromosome 16 at 29,403,845 bp
  • T to A, chromosome 16 at 29,958,562 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • T to A, chromosome 17 at 71,714,242 bp
  • T to A, chromosome 18 at 10,515,371 bp
  • C to T, chromosome 18 at 12,407,551 bp
  • T to A, chromosome 18 at 77,185,462 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8227 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067644-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.