Strain Name:
C57BL/6J-MtgxR8266Btlr/Mmmh
Stock Number:
067691-MU
Citation ID:
RRID:MMRRC_067691-MU
Other Names:
R8266 (G1)
Major Collection:

Strain Information

Zfp113
Name: zinc finger protein 113
Synonyms: 4732456B05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56314
Homologene: 50027
Rps6ka1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: Rsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20111
Homologene: 55703
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Zfp609
Name: zinc finger protein 609
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214812
Homologene: 72220
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Kat6b
Name: K(lysine) acetyltransferase 6B
Synonyms: qkf, querkopf, Morf, B130044K16Rik, monocytic leukemia, Myst4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54169
Homologene: 136480
Exoc6
Name: exocyst complex component 6
Synonyms: msec15, 4833405E05Rik, Sec15, Sec15l1, hbd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107371
VEGA: 19
Homologene: 41305
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: argonaute 3, eIF2C3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Mcm3ap
Name: minichromosome maintenance complex component 3 associated protein
Synonyms: GANP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54387
VEGA: 10
HGNC: HGNC:6946
Homologene: 2902
Ppfia1
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Synonyms: liprin, C030014K08Rik, Liprin-alpha1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233977
HGNC: HGNC:9245
Homologene: 20802
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Isl2
Name: insulin related protein 2 (islet 2)
Synonyms: islet 2, islet-2, 3110001N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104360
Homologene: 10730
Fuca2
Name: fucosidase, alpha-L- 2, plasma
Synonyms: 5530401P20Rik, 0610025O11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66848
HGNC: HGNC:4008
Homologene: 119
Septin2
Name: septin 2
Synonyms: Nedd5, Sept2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18000
HGNC: HGNC:7729
Homologene: 3243
Abcf2
Name: ATP-binding cassette, sub-family F member 2
Synonyms: 0710005O05Rik, Drr3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27407
Homologene: 21408
Hrob
Name: homologous recombination factor with OB-fold
Synonyms: BC030867
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217216
Homologene: 69368
Rnft2
Name: ring finger protein, transmembrane 2
Synonyms: B830028P19Rik, Tmem118
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269695
Homologene: 41892
Sigirr
Name: single immunoglobulin and toll-interleukin 1 receptor (TIR) domain
Synonyms: Sigirr, Tir8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 24058
Homologene: 36399
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Wdr72
Name: WD repeat domain 72
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546144
Homologene: 52326
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
C7
Name: complement component 7
Synonyms: LOC383055
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109828
VEGA: 15
HGNC: HGNC:1346
Homologene: 489
Tmx4
Name: thioredoxin-related transmembrane protein 4
Synonyms: 4930500L08Rik, 2810417D04Rik, D2Bwg1356e, Txndc13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52837
Homologene: 10901
Stox2
Name: storkhead box 2
Synonyms: 4933409N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71069
Homologene: 18414
Or51ai2
Name: olfactory receptor family 51 subfamily AI member 2
Synonyms: GA_x6K02T2PBJ9-6671256-6672209, MOR2-1, Olfr632
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259123
Homologene: 64963
Grik1
Name: glutamate receptor, ionotropic, kainate 1
Synonyms: Glur-5, Glur5, D16Ium24, A830007B11Rik, D16Ium24e, Glurbeta1, GluK5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14805
HGNC: HGNC:4579
Homologene: 68992
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232367
Col16a1
Name: collagen, type XVI, alpha 1
Synonyms: [a]1 (XVI) collagen, 2700007F12Rik, A530052M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107581
HGNC: HGNC:2193
Homologene: 1397
Map7d1
Name: MAP7 domain containing 1
Synonyms: Parcc1, Rprc1, Mtap7d1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 245877
Homologene: 17009
Mybphl
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68753
Homologene: 19221
Cfap20dc
Name: CFAP20 domain containing
Synonyms: 4930452B06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74430
Homologene: 18873
Pde6a
Name: phosphodiesterase 6A, cGMP-specific, rod, alpha
Synonyms: Pdea
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225600
HGNC: HGNC:8785
Homologene: 380
Or2o1
Name: olfactory receptor family 2 subfamily O member 1
Synonyms: GA_x6K02T2QP88-6274566-6273628, MOR280-1, Olfr1394
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258273
Homologene: 138305
Chrnb1
Name: cholinergic receptor nicotinic beta 1 subunit
Synonyms: Achr-2, Acrb, AChR beta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11443
HGNC: HGNC:1961
Homologene: 594
Cyp3a25
Name: cytochrome P450, family 3, subfamily a, polypeptide 25
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56388
Homologene: 135775
Sec61a2
Name: SEC61 translocon subunit alpha 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57743
Homologene: 38481
Bmp8a
Name: bone morphogenetic protein 8a
Synonyms: osteogenic protein 2, OP2, Bmp7r1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12163
Homologene: 135983
Foxf2
Name: forkhead box F2
Synonyms: FREAC2, Fkh20, LUN
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14238
HGNC: HGNC:3810
Homologene: 1115
Ccpg1
Name: cell cycle progression 1
Synonyms: 1700030B06Rik, 1810073J13Rik, D9Ertd392e, 9430028F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72278
Homologene: 3487
A630073D07Rik
Name: RIKEN cDNA A630073D07 gene
Synonyms: LOC381819
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381819
Lpar3
Name: lysophosphatidic acid receptor 3
Synonyms: LPA3, Edg7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 65086
Homologene: 8123
Pdilt
Name: protein disulfide isomerase-like, testis expressed
Synonyms: PDILT, 1700007B13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71830
Homologene: 18382
Reg1
Name: regenerating islet-derived 1
Synonyms: pancreatic stone protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19692
Homologene: 68282
Ska1
Name: spindle and kinetochore associated complex subunit 1
Synonyms: 2810433K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66468
VEGA: 18
Homologene: 11975
AW146154
Name: expressed sequence AW146154
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101835
Homologene: 134516
Spink2
Name: serine peptidase inhibitor, Kazal type 2
Synonyms: acrosin-trypsin inhibitor, 1700007F22Rik, HUSI-II
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69982
Homologene: 134017
1700001O22Rik
Name: RIKEN cDNA 1700001O22 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73598
Homologene: 18859
Gm527
Name: predicted gene 527
Synonyms: LOC217648
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217648
VEGA: 12
Homologene: 19024
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Gm5849
Name: predicted gene 5849
Type: Gene
Species: Mouse
Chromosome: 3
Cecr6
Name:
Type: Gene
Species: Mouse
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 40,011,653 bp
  • T to C, chromosome 1 at 93,501,526 bp
  • G to T, chromosome 1 at 164,185,124 bp
  • A to G, chromosome 2 at 5,876,839 bp
  • T to A, chromosome 2 at 30,801,242 bp
  • A to T, chromosome 2 at 67,508,574 bp
  • T to C, chromosome 2 at 134,639,541 bp
  • T to C, chromosome 3 at 90,777,851 bp
  • T to C, chromosome 3 at 108,377,360 bp
  • C to T, chromosome 3 at 146,240,630 bp
  • G to A, chromosome 4 at 123,315,833 bp
  • G to A, chromosome 4 at 126,238,560 bp
  • T to A, chromosome 4 at 126,376,928 bp
  • G to A, chromosome 4 at 130,065,431 bp
  • A to G, chromosome 4 at 133,863,684 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • A to T, chromosome 4 at 144,109,112 bp
  • T to A, chromosome 5 at 22,018,087 bp
  • CAT to CATAAT, chromosome 5 at 24,576,591 bp
  • T to G, chromosome 5 at 77,211,366 bp
  • T to C, chromosome 5 at 110,294,920 bp
  • T to A, chromosome 5 at 118,237,558 bp
  • T to G, chromosome 5 at 118,742,109 bp
  • C to T, chromosome 5 at 138,150,619 bp
  • A to T, chromosome 5 at 145,992,986 bp
  • T to A, chromosome 6 at 78,427,359 bp
  • T to C, chromosome 6 at 120,492,232 bp
  • A to G, chromosome 6 at 124,191,978 bp
  • C to T, chromosome 6 at 132,627,417 bp
  • G to A, chromosome 7 at 41,481,168 bp
  • T to C, chromosome 7 at 103,937,539 bp
  • C to T, chromosome 7 at 119,489,381 bp
  • T to C, chromosome 7 at 141,091,749 bp
  • T to C, chromosome 7 at 144,514,494 bp
  • C to T, chromosome 8 at 47,192,025 bp
  • A to G, chromosome 8 at 84,559,219 bp
  • A to G, chromosome 9 at 55,544,124 bp
  • G to T, chromosome 9 at 65,703,714 bp
  • G to A, chromosome 9 at 73,005,719 bp
  • A to T, chromosome 9 at 74,143,492 bp
  • T to A, chromosome 10 at 13,512,889 bp
  • A to T, chromosome 10 at 76,476,580 bp
  • A to G, chromosome 10 at 100,559,671 bp
  • T to A, chromosome 11 at 23,486,810 bp
  • T to A, chromosome 11 at 49,160,525 bp
  • T to C, chromosome 11 at 69,784,621 bp
  • T to A, chromosome 11 at 102,262,220 bp
  • T to C, chromosome 12 at 64,920,945 bp
  • T to A, chromosome 12 at 73,108,649 bp
  • AGCCTCCTTACTCG to AGCCTCCTTACTCGCCTCCTTACTCG, chromosome 13 at 31,626,378 bp
  • G to A, chromosome 14 at 8,482,599 bp
  • C to T, chromosome 14 at 21,516,845 bp
  • T to A, chromosome 15 at 5,007,659 bp
  • A to G, chromosome 16 at 87,947,979 bp
  • A to T, chromosome 18 at 3,309,535 bp
  • T to C, chromosome 18 at 49,843,811 bp
  • T to A, chromosome 18 at 61,258,213 bp
  • T to C, chromosome 18 at 74,204,341 bp
  • A to G, chromosome 19 at 37,577,049 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8266 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067691-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.