Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8315Btlr/Mmmh
Stock Number:
067720-MU
Citation ID:
RRID:MMRRC_067720-MU
Other Names:
R8315 (G1)
Major Collection:

Strain Information

Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Emx1
Name: empty spiracles homeobox 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13796
HGNC: HGNC:3340
Homologene: 55799
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Zfp523
Name: zinc finger protein 523
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224656
Homologene: 2569
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, 9530011I20Rik, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,284,420 bp
  • A to G, chromosome 1 at 135,256,576 bp
  • T to C, chromosome 1 at 149,886,214 bp
  • A to T, chromosome 1 at 153,243,421 bp
  • G to A, chromosome 2 at 74,683,122 bp
  • C to A, chromosome 2 at 87,418,651 bp
  • G to T, chromosome 2 at 104,590,581 bp
  • C to T, chromosome 2 at 120,403,960 bp
  • ATCCTCCTCCTCCTCCTCC to ATCCTCCTCCTCCTCC, chromosome 2 at 130,770,735 bp
  • A to T, chromosome 2 at 151,655,240 bp
  • C to T, chromosome 2 at 175,171,847 bp
  • A to G, chromosome 3 at 88,313,257 bp
  • A to T, chromosome 3 at 119,314,885 bp
  • AAAGAACCGTGTATACCGCCTGGGATGGAAAGAA to AAA, chromosome 4 at 43,569,937 bp
  • A to G, chromosome 4 at 45,489,079 bp
  • A to C, chromosome 4 at 49,681,705 bp
  • A to T, chromosome 4 at 57,270,063 bp
  • A to T, chromosome 4 at 72,126,191 bp
  • C to T, chromosome 4 at 142,141,691 bp
  • G to T, chromosome 4 at 153,432,356 bp
  • A to G, chromosome 5 at 34,109,373 bp
  • G to A, chromosome 5 at 96,743,182 bp
  • G to T, chromosome 5 at 103,811,090 bp
  • C to T, chromosome 5 at 146,268,251 bp
  • T to C, chromosome 6 at 17,533,957 bp
  • A to G, chromosome 6 at 85,194,106 bp
  • T to A, chromosome 7 at 46,729,628 bp
  • A to T, chromosome 7 at 47,601,303 bp
  • T to A, chromosome 7 at 84,994,724 bp
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,923 bp
  • T to C, chromosome 9 at 38,180,209 bp
  • C to T, chromosome 9 at 42,387,825 bp
  • T to C, chromosome 9 at 65,080,851 bp
  • C to A, chromosome 9 at 107,984,307 bp
  • T to C, chromosome 10 at 27,422,659 bp
  • G to A, chromosome 10 at 129,647,653 bp
  • A to T, chromosome 11 at 9,378,460 bp
  • A to G, chromosome 11 at 9,585,502 bp
  • A to G, chromosome 11 at 16,875,027 bp
  • G to T, chromosome 12 at 30,884,851 bp
  • A to G, chromosome 12 at 85,095,408 bp
  • T to A, chromosome 12 at 112,781,133 bp
  • A to G, chromosome 13 at 23,250,169 bp
  • C to A, chromosome 14 at 52,851,602 bp
  • T to C, chromosome 14 at 67,023,728 bp
  • T to G, chromosome 15 at 73,589,556 bp
  • G to A, chromosome 15 at 78,347,381 bp
  • T to C, chromosome 15 at 78,378,486 bp
  • G to T, chromosome 16 at 11,075,601 bp
  • A to G, chromosome 16 at 22,822,814 bp
  • C to T, chromosome 16 at 23,613,248 bp
  • C to A, chromosome 16 at 49,120,018 bp
  • A to G, chromosome 17 at 14,970,455 bp
  • A to T, chromosome 17 at 25,845,425 bp
  • G to A, chromosome 17 at 28,202,588 bp
  • A to G, chromosome 17 at 32,482,202 bp
  • C to A, chromosome 17 at 33,067,064 bp
  • A to G, chromosome 17 at 34,592,733 bp
  • A to G, chromosome 17 at 36,119,013 bp
  • A to G, chromosome 17 at 50,002,637 bp
  • T to C, chromosome 18 at 44,396,004 bp
  • C to T, chromosome 19 at 4,143,470 bp
  • T to A, chromosome 19 at 21,417,071 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8315 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067720-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.