Strain Name:
C57BL/6J-MtgxR8376Btlr/Mmmh
Stock Number:
067744-MU
Citation ID:
RRID:MMRRC_067744-MU
Other Names:
R8376 (G1)
Major Collection:

Strain Information

Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Mgrn1
Name: mahogunin, ring finger 1
Synonyms: nc, 2610042J20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17237
VEGA: 16
Homologene: 41020
Ddb1
Name: damage specific DNA binding protein 1
Synonyms: p127-Ddb1, damage-specific DNA-binding protein, DNA repair, DNA repair protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13194
VEGA: 19
HGNC: HGNC:2717
Homologene: 1448
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ubtf
Name: upstream binding transcription factor, RNA polymerase I
Synonyms: UBF1, Tcfubf, UBF, A930005G04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21429
Homologene: 7970
Pdcd6ip
Name: programmed cell death 6 interacting protein
Synonyms: Alix, AIP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18571
HGNC: HGNC:8766
Homologene: 22614
Bmpr2
Name: bone morphogenetic protein receptor type 2
Synonyms: BMPR-II, BMP-2, 2610024H22Rik, BMPRII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12168
HGNC: HGNC:1078
Homologene: 929
Myc
Name: myelocytomatosis oncogene
Synonyms: c-myc, Nird, Niard, Myc2, bHLHe39
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17869
HGNC: HGNC:7553
Homologene: 31092
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: 0710008O11Rik, BRMS1, D12Ertd407e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Adam32
Name: a disintegrin and metallopeptidase domain 32
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 353188
Homologene: 17021
Cdc42
Name: cell division cycle 42
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12540
HGNC: HGNC:1736
Homologene: 137230
Zfp65
Name: zinc finger protein 65
Synonyms: KRAB5, Zfp71-rs1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 235907
Homologene: 87875
Rnf4
Name: ring finger protein 4
Synonyms: Gtrgeo8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19822
Homologene: 37711
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Ino80
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68142
Homologene: 75070
Osbpl10
Name: oxysterol binding protein-like 10
Synonyms: 4933433D06Rik, OPR-10, C820004B04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74486
Homologene: 69240
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, B430218L07Rik, Vwcd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Atp12a
Name: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Synonyms: cHKA, Atp1al1, HKalpha2, ATPase H+K+-transporting, alpha 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192113
VEGA: 14
Homologene: 68197
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Kcnn4
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Synonyms: SK4, IK1, mIKCa1, IKCa1, KCa3.1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16534
HGNC: HGNC:6293
Homologene: 1696
Uroc1
Name: urocanase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243537
Homologene: 76629
Plcb3
Name: phospholipase C, beta 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18797
VEGA: 19
HGNC: HGNC:9056
Homologene: 47960
Fsip1
Name: fibrous sheath-interacting protein 1
Synonyms: 4933432K11Rik, 1700012M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71313
Homologene: 12390
Phf8l
Name: PHD finger protein 8 like
Synonyms: 4921501E09Rik, Phf8-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74042
VEGA: 17
Homologene: 66275
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627132
Homologene: 129750
Dhx30
Name: DExH-box helicase 30
Synonyms: Ddx30, 2810477H02Rik, C130058C04Rik, helG, DEAH (Asp-Glu-Ala-His) box polypeptide 30
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Elp4
Name: elongator acetyltransferase complex subunit 4
Synonyms: Paxneb, A330107A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77766
HGNC: HGNC:1171
Homologene: 32433
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Lrrc4b
Name: leucine rich repeat containing 4B
Synonyms: Lrig4, NGL-3, Ngl3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272381
Homologene: 45681
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Nox4
Name: NADPH oxidase 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50490
HGNC: HGNC:7891
Homologene: 41065
Apba2
Name: amyloid beta precursor protein binding family A member 2
Synonyms: X11-like, X11L, Mint 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11784
HGNC: HGNC:579
Homologene: 4021
Zw10
Name: zw10 kinetochore protein
Synonyms: MmZw10, 6330566F14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26951
VEGA: 9
Homologene: 37959
Pde3a
Name: phosphodiesterase 3A, cGMP inhibited
Synonyms: A930022O17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54611
HGNC: HGNC:8778
Homologene: 708
Plk5
Name: polo like kinase 5
Synonyms: 6330514A18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216166
Homologene: 28072
Ankrd40
Name: ankyrin repeat domain 40
Synonyms: 5530600A18Rik, Gcap15, 1110011C06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71452
Homologene: 12393
Gc
Name: vitamin D binding protein
Synonyms: DBP, vitamin D binding protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14473
HGNC: HGNC:4187
Homologene: 486
Cfhr1
Name: complement factor H-related 1
Synonyms: Cfhl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50702
Homologene: 55632
Cacnb4
Name: calcium channel, voltage-dependent, beta 4 subunit
Synonyms: Cchb4, 3110038O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12298
HGNC: HGNC:1404
Homologene: 20188
Prl7a1
Name: prolactin family 7, subfamily a, member 1
Synonyms: PLP-G, PLP-E, Prlpg, Prlpe
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19113
Homologene: 136279
Tbc1d12
Name: TBC1D12: TBC1 domain family, member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 209478
VEGA: 19
Homologene: 50835
Or52w1
Name: olfactory receptor family 52 subfamily W member 1
Synonyms: GA_x6K02T2PBJ9-7994144-7995106, MOR36-1, Olfr692
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258352
Homologene: 64859
Gpt2
Name: glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms: ALT2, 4631422C05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108682
Homologene: 68832
Taldo1
Name: transaldolase 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21351
Homologene: 4916
Slc15a1
Name: solute carrier family 15 (oligopeptide transporter), member 1
Synonyms: PECT1, PEPT1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56643
VEGA: 14
Homologene: 38006
Mtx1
Name: metaxin 1
Synonyms: Gcap6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17827
HGNC: HGNC:7504
Homologene: 37623
Vmn1r55
Name: vomeronasal 1 receptor 55
Synonyms: LOC236535, LOC384522, V1rd5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384522
Homologene: 41799
Krtap4-7
Name: keratin associated protein 4-7
Synonyms: KRTAP4.7, KAP4.7, 2310037K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76444
Homologene: 137394
Alkal2
Name: ALK and LTK ligand 2
Synonyms: 6230419C23Rik, Fam150b, Augalpha, Augmentor alpha
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100294583
VEGA: 12
Homologene: 87330
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 59,867,356 bp
  • A to C, chromosome 1 at 139,547,811 bp
  • T to C, chromosome 1 at 179,782,955 bp
  • G to A, chromosome 2 at 52,464,653 bp
  • A to G, chromosome 2 at 105,842,308 bp
  • C to T, chromosome 2 at 118,233,038 bp
  • A to T, chromosome 2 at 119,442,487 bp
  • G to A, chromosome 3 at 55,643,655 bp
  • A to G, chromosome 3 at 89,214,171 bp
  • G to A, chromosome 4 at 100,974,876 bp
  • G to A, chromosome 4 at 137,328,894 bp
  • C to T, chromosome 5 at 34,351,357 bp
  • T to C, chromosome 5 at 64,955,112 bp
  • G to A, chromosome 5 at 89,438,259 bp
  • A to G, chromosome 5 at 142,158,621 bp
  • A to T, chromosome 6 at 90,337,715 bp
  • A to G, chromosome 6 at 141,481,221 bp
  • T to A, chromosome 7 at 5,146,870 bp
  • C to A, chromosome 7 at 24,377,626 bp
  • T to C, chromosome 7 at 44,462,594 bp
  • T to A, chromosome 7 at 64,695,593 bp
  • C to T, chromosome 7 at 80,360,923 bp
  • A to G, chromosome 7 at 87,374,384 bp
  • CGGCGGCGG to CGGCGGCGGAGGCGGCGG, chromosome 7 at 97,579,917 bp
  • C to A, chromosome 7 at 105,368,640 bp
  • T to C, chromosome 7 at 141,401,875 bp
  • A to C, chromosome 8 at 24,919,920 bp
  • A to T, chromosome 8 at 85,493,065 bp
  • CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA to CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA, chromosome 8 at 109,623,788 bp
  • A to T, chromosome 9 at 49,077,483 bp
  • G to A, chromosome 9 at 110,088,639 bp
  • A to T, chromosome 9 at 113,689,616 bp
  • G to A, chromosome 9 at 115,223,593 bp
  • C to T, chromosome 10 at 5,043,615 bp
  • T to C, chromosome 10 at 80,360,345 bp
  • G to T, chromosome 11 at 94,334,836 bp
  • A to G, chromosome 11 at 99,643,927 bp
  • A to C, chromosome 11 at 102,308,911 bp
  • G to T, chromosome 12 at 30,884,851 bp
  • C to A, chromosome 12 at 55,841,629 bp
  • T to G, chromosome 13 at 27,637,655 bp
  • A to C, chromosome 13 at 67,708,918 bp
  • A to G, chromosome 14 at 31,301,346 bp
  • G to T, chromosome 14 at 56,374,626 bp
  • A to G, chromosome 14 at 103,572,015 bp
  • A to G, chromosome 14 at 121,480,703 bp
  • T to A, chromosome 15 at 54,910,095 bp
  • A to T, chromosome 15 at 61,987,546 bp
  • T to A, chromosome 16 at 4,915,766 bp
  • T to A, chromosome 17 at 18,304,968 bp
  • C to A, chromosome 17 at 33,067,064 bp
  • T to A, chromosome 17 at 46,942,795 bp
  • C to T, chromosome 17 at 74,589,640 bp
  • A to G, chromosome 19 at 6,966,703 bp
  • G to A, chromosome 19 at 10,619,305 bp
  • A to G, chromosome 19 at 38,901,409 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8376 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067744-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.