Strain Name:
C57BL/6J-MtgxR8293Btlr/Mmmh
Stock Number:
067783-MU
Citation ID:
RRID:MMRRC_067783-MU
Other Names:
R8293 (G1)
Major Collection:

Strain Information

Chrm4
Name: cholinergic receptor, muscarinic 4
Synonyms: Chrm-4, muscarinic acetylcholine receptor 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12672
HGNC: HGNC:1953
Homologene: 20192
Dtnbp1
Name: dystrobrevin binding protein 1
Synonyms: dysbindin, 5430437B18Rik, sdy, Bloc1s8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94245
VEGA: 13
Homologene: 12037
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Slc12a8
Name: solute carrier family 12 (potassium/chloride transporters), member 8
Synonyms: E330020C02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 171286
Homologene: 11628
Gcm2
Name: glial cells missing homolog 2
Synonyms: Gcm1-rs2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107889
VEGA: 13
HGNC: HGNC:4198
Homologene: 3490
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, Tls, hnRNP P2, pigpen, D930039C12Rik, D430004D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Stip1
Name: stress-induced phosphoprotein 1
Synonyms: p60, IEF SSP 3521, Hop, Hsp70/Hsp90 organizing protein, STI1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20867
VEGA: 19
Homologene: 4965
Tank
Name: TRAF family member-associated Nf-kappa B activator
Synonyms: I-TRAF, E430026L09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21353
Homologene: 3081
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Prpf31
Name: pre-mRNA processing factor 31
Synonyms: 2810404O06Rik, PRP31, RP11, 1500019O16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68988
Homologene: 5980
Cd200r1
Name: CD200 receptor 1
Synonyms: OX2R, CD200R, Mox2r
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57781
Homologene: 10957
Ms4a6c
Name: membrane-spanning 4-domains, subfamily A, member 6C
Synonyms: 2200009H22Rik, 2210417N07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73656
Homologene: 130765
E2f4
Name: E2F transcription factor 4
Synonyms: 2010111M04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104394
HGNC: HGNC:3118
Homologene: 1471
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16319
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Arap1
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Synonyms: 2410002L19Rik, Centd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69710
Homologene: 12326
Tcerg1
Name: transcription elongation regulator 1 (CA150)
Synonyms: p144, ca150, Taf2s, 2410022J09Rik, 2900090C16Rik, Fbp28
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56070
Homologene: 4879
Agap3
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Synonyms: MRIP-1, Crag, Centg3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213990
Homologene: 23742
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Or4f62
Name: olfactory receptor family 4 subfamily F member 62
Synonyms: GA_x6K02T2Q125-73202172-73203134, MOR245-16, Olfr1318
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258022
Homologene: 134079
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117147
Homologene: 24930
Nxpe5
Name: neurexophilin and PC-esterase domain family, member 5
Synonyms: Fam55 related, BC055004
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381680
Homologene: 134143
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Or10ak12
Name: olfactory receptor family 10 subfamily AK member 12
Synonyms: GA_x6K02T2QD9B-18726774-18727577, GA_x6K02T2QD9B-18723799-18724749, MOR259-12, MOR259-5, Olfr1335, Olfr1334-ps1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435804
Homologene: 138635
Cyp2c39
Name: cytochrome P450, family 2, subfamily c, polypeptide 39
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13098
Homologene: 117948
Heca
Name: hdc homolog, cell cycle regulator
Synonyms: LOC380629
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380629
VEGA: 10
Homologene: 32300
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50720
Ces2b
Name: carboxyesterase 2B
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234669
HGNC: HGNC:1864
Homologene: 135851
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Chrna1
Name: cholinergic receptor nicotinic alpha 1 subunit
Synonyms: Achr-1, Acra
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11435
HGNC: HGNC:1955
Homologene: 59
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Cts8
Name: cathepsin 8
Synonyms: Epcs70, Epcs68, CTS2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56094
VEGA: 13
Homologene: 129897
Rnf130
Name: ring finger protein 130
Synonyms: G1RP, 2510042A13Rik, G1RZFP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 59044
Homologene: 41267
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
D630023F18Rik
Name: RIKEN cDNA D630023F18 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98303
Homologene: 129674
1700113H08Rik
Name: RIKEN cDNA 1700113H08 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76640
Homologene: 45695
Dtx3
Name: deltex 3, E3 ubiquitin ligase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 80904
Homologene: 12754
Pla2g5
Name: phospholipase A2, group V
Synonyms: sPLA2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18784
HGNC: HGNC:9038
Homologene: 716
Lvrn
Name: laeverin
Synonyms: 4833403I15Rik, Aqpep
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74574
VEGA: 18
Homologene: 51352
Or8g26
Name: olfactory receptor family 8 subfamily G member 26
Synonyms: GA_x6K02T2PVTD-32881408-32882343, MOR171-44, Olfr943
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258323
VEGA: 9
HGNC: HGNC:8484
Homologene: 110526
Wnt10a
Name: wingless-type MMTV integration site family, member 10A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22409
Homologene: 22525
Gbp10
Name: guanylate-binding protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 626578
Homologene: 128731
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Pcdp1, Gm101
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226356
Homologene: 88578
Nab2
Name: Ngfi-A binding protein 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17937
HGNC: HGNC:7627
Homologene: 4353
Or5p4
Name: olfactory receptor family 5 subfamily P member 4
Synonyms: GA_x6K02T2PBJ9-10409785-10410723, MOR204-2, MOR204-39, Olfr481
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258927
Homologene: 105166
Slc35f2
Name: solute carrier family 35, member F2
Synonyms: 1500009K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72022
VEGA: 9
Homologene: 36363
Fbxo40
Name: F-box protein 40
Synonyms: 9830003A13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207215
Homologene: 9459
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Adam4
Name: a disintegrin and metallopeptidase domain 4
Synonyms: tMDCV
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11498
Homologene: 86950
Taar8c
Name: trace amine-associated receptor 8C
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 494546
Homologene: 77586
Ccdc9b
Name: coiled-coil domain containing 9B
Synonyms: A430105I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214239
Homologene: 128188
Cxcl2
Name: C-X-C motif chemokine ligand 2
Synonyms: MIP-2, Mip2, Scyb, Scyb2, Mgsa-b, MIP-2a, CINC-2a, GROb, Gro2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20310
Homologene: 117695
Bnip5
Name: BCL2 interacting protein 5
Synonyms: 4930539E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207819
Homologene: 52098
Smok2a
Name: sperm motility kinase 2A
Synonyms: Smok2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27263
Homologene: 128738
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 65,108,780 bp
  • G to T, chromosome 1 at 74,803,217 bp
  • A to G, chromosome 1 at 119,981,774 bp
  • A to T, chromosome 2 at 52,246,815 bp
  • T to A, chromosome 2 at 61,644,414 bp
  • T to A, chromosome 2 at 73,570,506 bp
  • C to T, chromosome 2 at 91,928,218 bp
  • A to T, chromosome 2 at 112,156,253 bp
  • T to A, chromosome 2 at 118,761,315 bp
  • T to C, chromosome 2 at 120,862,721 bp
  • A to G, chromosome 4 at 85,033,838 bp
  • T to A, chromosome 4 at 118,809,742 bp
  • A to G, chromosome 4 at 138,804,606 bp
  • A to C, chromosome 5 at 24,487,885 bp
  • A to T, chromosome 5 at 43,688,228 bp
  • A to G, chromosome 5 at 63,805,320 bp
  • A to T, chromosome 5 at 90,904,229 bp
  • A to C, chromosome 5 at 105,224,369 bp
  • A to G, chromosome 5 at 110,708,892 bp
  • A to T, chromosome 5 at 138,230,542 bp
  • C to T, chromosome 7 at 3,640,918 bp
  • A to T, chromosome 7 at 101,400,934 bp
  • A to T, chromosome 7 at 108,081,062 bp
  • T to G, chromosome 7 at 119,638,096 bp
  • T to C, chromosome 7 at 127,972,577 bp
  • A to T, chromosome 8 at 48,367,422 bp
  • A to C, chromosome 8 at 104,832,626 bp
  • A to G, chromosome 8 at 105,297,819 bp
  • A to G, chromosome 9 at 21,353,688 bp
  • A to G, chromosome 9 at 39,184,393 bp
  • G to A, chromosome 9 at 53,816,940 bp
  • A to G, chromosome 10 at 17,902,263 bp
  • C to T, chromosome 10 at 24,101,117 bp
  • T to C, chromosome 10 at 52,087,918 bp
  • T to C, chromosome 10 at 87,226,002 bp
  • A to G, chromosome 10 at 127,191,013 bp
  • C to A, chromosome 10 at 127,666,397 bp
  • T to A, chromosome 11 at 50,095,796 bp
  • C to A, chromosome 11 at 69,992,672 bp
  • T to A, chromosome 12 at 81,420,411 bp
  • A to G, chromosome 13 at 41,103,170 bp
  • G to A, chromosome 13 at 44,931,139 bp
  • A to G, chromosome 13 at 54,526,546 bp
  • A to G, chromosome 13 at 61,254,068 bp
  • T to C, chromosome 13 at 97,942,521 bp
  • T to C, chromosome 14 at 32,974,261 bp
  • T to A, chromosome 14 at 61,191,099 bp
  • ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT to ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT, chromosome 15 at 76,002,775 bp
  • A to T, chromosome 16 at 33,540,978 bp
  • T to C, chromosome 16 at 36,970,025 bp
  • A to G, chromosome 16 at 44,789,721 bp
  • A to C, chromosome 17 at 13,226,904 bp
  • T to C, chromosome 17 at 28,902,890 bp
  • A to G, chromosome 18 at 42,560,955 bp
  • C to A, chromosome 18 at 46,850,565 bp
  • T to C, chromosome 19 at 7,034,250 bp
  • G to A, chromosome 19 at 9,875,133 bp
  • A to T, chromosome 19 at 10,252,037 bp
  • T to A, chromosome 19 at 11,478,296 bp
  • A to T, chromosome 19 at 16,668,605 bp
  • G to T, chromosome 19 at 39,563,967 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8293 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067783-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.