Strain Name:
C57BL/6J-MtgxR8330Btlr/Mmmh
Stock Number:
067799-MU
Citation ID:
RRID:MMRRC_067799-MU
Other Names:
R8330 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
S1pr3
Name: sphingosine-1-phosphate receptor 3
Synonyms: LPb3, S1P3, Edg3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13610
VEGA: 13
HGNC: HGNC:3167
Homologene: 3829
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Exoc2
Name: exocyst complex component 2
Synonyms: Sec5, 2410030I24Rik, Sec5l1, Gm29675
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66482
Homologene: 10122
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Rab31
Name: RAB31, member RAS oncogene family
Synonyms: 1700093E07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106572
VEGA: 17
HGNC: HGNC:9771
Homologene: 5001
Zfp160
Name: zinc finger protein 160
Synonyms: 6720480D16Rik, 6720480D16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224585
VEGA: 17
Homologene: 137372
Tmem43
Name: transmembrane protein 43
Synonyms: 1200015A22Rik, LUMA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74122
Homologene: 11532
Klhl23
Name: kelch-like 23
Synonyms: C130068N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277396
Homologene: 18628
Mpp3
Name: membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms: Dlgh3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13384
HGNC: HGNC:7221
Homologene: 31065
Ppib
Name: peptidylprolyl isomerase B
Synonyms: cyclophilin B, CyP-20b, Cphn-2, Cphn2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19035
VEGA: 9
HGNC: HGNC:9255
Homologene: 726
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Sbsn
Name: suprabasin
Synonyms: 1110005D19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 282619
Homologene: 17900
Mgl2
Name: macrophage galactose N-acetyl-galactosamine specific lectin 2
Synonyms: CD301b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216864
Homologene: 7836
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Xpr1
Name: xenotropic and polytropic retrovirus receptor 1
Synonyms: suppressor of yeast Ga deletion, Syg1, Rmc-1, Rmc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19775
Homologene: 134226
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Nek9
Name: NIMA (never in mitosis gene a)-related expressed kinase 9
Synonyms: C130021H08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217718
Homologene: 13222
Parp3
Name: poly (ADP-ribose) polymerase family, member 3
Synonyms: Adprt3, PARP-3, A930002C11Rik, Adprtl3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235587
HGNC: HGNC:273
Homologene: 4005
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279029
Homologene: 19586
Vmn2r80
Name: vomeronasal 2, receptor 80
Synonyms: EG624765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624765
Homologene: 83483
Rsad2
Name: radical S-adenosyl methionine domain containing 2
Synonyms: Vig1, cig5, 2510004L01Rik, viperin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58185
Homologene: 10969
Or10a49
Name: olfactory receptor family 10 subfamily A member 49
Synonyms: GA_x6K02T2PBJ9-11199311-11198367, MOR268-4, Olfr517
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258136
Homologene: 79413
Pex6
Name: peroxisomal biogenesis factor 6
Synonyms: D130055I09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224824
HGNC: HGNC:8859
Homologene: 47914
Ifi47
Name: interferon gamma inducible protein 47
Synonyms: 47kDa, IRG-47, Iigp4, Igrd
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15953
Homologene: 49169
Cdr2l
Name: cerebellar degeneration-related protein 2-like
Synonyms: D030068L24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237988
Homologene: 35390
Klri2
Name: killer cell lectin-like receptor family I member 2
Synonyms: A530090P03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320407
Homologene: 86736
Zfp955a
Name: zinc finger protein 955A
Synonyms: AI842447
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77652
VEGA: 17
Homologene: 104925
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Pabpc1l
Name: poly(A) binding protein, cytoplasmic 1-like
Synonyms: ePAB, 1810053B01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381404
Homologene: 77989
Acsl6
Name: acyl-CoA synthetase long-chain family member 6
Synonyms: Lacsl, A330035H04Rik, Facl6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216739
Homologene: 100939
Or4f14
Name: olfactory receptor family 4 subfamily F member 14
Synonyms: GA_x6K02T2Q125-72954873-72953935, MOR245-15, Olfr1306
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258023
Homologene: 128383
Or51k2
Name: olfactory receptor family 51 subfamily K member 2
Synonyms: GA_x6K02T2PBJ9-6681230-6682168, MOR12-5, Olfr633
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258351
Homologene: 27136
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93709
HGNC: HGNC:8696
Homologene: 56824
Selenoh
Name: selenoprotein H
Synonyms: SelH, 2700094K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72657
Homologene: 86009
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 155,313,255 bp
  • A to T, chromosome 2 at 26,951,503 bp
  • T to G, chromosome 2 at 52,227,408 bp
  • T to C, chromosome 2 at 69,824,152 bp
  • G to T, chromosome 2 at 84,670,347 bp
  • A to G, chromosome 2 at 111,912,379 bp
  • G to A, chromosome 2 at 164,027,648 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 4 at 40,812,787 bp
  • A to G, chromosome 5 at 14,675,297 bp
  • A to T, chromosome 5 at 25,304,694 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • T to C, chromosome 6 at 91,478,764 bp
  • T to A, chromosome 6 at 129,733,731 bp
  • T to A, chromosome 7 at 30,751,941 bp
  • T to G, chromosome 7 at 103,947,403 bp
  • A to T, chromosome 7 at 108,868,839 bp
  • C to T, chromosome 7 at 140,296,318 bp
  • T to C, chromosome 9 at 66,061,473 bp
  • T to C, chromosome 9 at 106,474,870 bp
  • T to A, chromosome 10 at 79,171,716 bp
  • A to G, chromosome 11 at 30,843,583 bp
  • A to G, chromosome 11 at 49,095,810 bp
  • A to G, chromosome 11 at 54,345,208 bp
  • A to G, chromosome 11 at 70,135,959 bp
  • T to C, chromosome 11 at 102,008,627 bp
  • T to C, chromosome 11 at 115,394,113 bp
  • A to T, chromosome 12 at 26,456,406 bp
  • A to G, chromosome 12 at 85,329,953 bp
  • A to G, chromosome 13 at 30,877,573 bp
  • G to T, chromosome 13 at 48,597,914 bp
  • G to A, chromosome 13 at 51,419,137 bp
  • GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA to GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA, chromosome 13 at 54,525,364 bp
  • C to T, chromosome 13 at 81,445,343 bp
  • T to A, chromosome 14 at 32,659,793 bp
  • T to A, chromosome 14 at 50,847,705 bp
  • T to A, chromosome 15 at 85,932,300 bp
  • T to C, chromosome 17 at 21,026,051 bp
  • C to T, chromosome 17 at 33,244,113 bp
  • T to C, chromosome 17 at 46,712,134 bp
  • A to T, chromosome 17 at 65,696,274 bp
  • A to T, chromosome 18 at 37,663,323 bp
  • T to C, chromosome 19 at 9,009,662 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8330 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067799-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.