Strain Name:
C57BL/6J-MtgxR8450Btlr/Mmmh
Stock Number:
067830-MU
Citation ID:
RRID:MMRRC_067830-MU
Other Names:
R8450 (G1)
Major Collection:

Strain Information

Cnmd
Name: chondromodulin
Synonyms: Chondromodulin 1, ChM-I, Bricd3, Chmd, Lect1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16840
Homologene: 5095
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Hap1
Name: huntingtin-associated protein 1
Synonyms: HAP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15114
HGNC: HGNC:4812
Homologene: 2935
Hsd17b4
Name: hydroxysteroid (17-beta) dehydrogenase 4
Synonyms: 17[b]-HSD, MFE-2, perMFE-2, multifunctional protein 2, D-bifunctional protein, Mfp-2, MFP2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15488
HGNC: HGNC:5213
Homologene: 358
Esyt2
Name: extended synaptotagmin-like protein 2
Synonyms: 2410017M09Rik, 4921504I16Rik, 2310058N22Rik, D12Ertd551e, Fam62b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52635
VEGA: 12
Homologene: 32699
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Mdc1
Name: mediator of DNA damage checkpoint 1
Synonyms: NFBD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240087
Homologene: 67092
Grid2ip
Name: glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonyms: delphilin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170935
Homologene: 15781
Fam81a
Name: family with sequence similarity 81, member A
Synonyms: 6430514L14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76886
Homologene: 17584
Lss
Name: lanosterol synthase
Synonyms: 2810025N20Rik, D10Ertd116e, Osc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16987
HGNC: HGNC:6708
Homologene: 37408
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Dmp1
Name: dentin matrix protein 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13406
HGNC: HGNC:2932
Homologene: 68396
Sbf1
Name: SET binding factor 1
Synonyms: Mtmr5, B230113C15Rik, 2610510A08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Cnp
Name: 2',3'-cyclic nucleotide 3' phosphodiesterase
Synonyms: Cnp-1, CNPase, Cnp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12799
HGNC: HGNC:2158
Homologene: 7672
Arhgef2
Name: Rho/Rac guanine nucleotide exchange factor 2
Synonyms: Lfc, GEF-H1, LFP40, GEFH1, P40, Lbcl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16800
HGNC: HGNC:682
Homologene: 3468
Nup50
Name: nucleoporin 50
Synonyms: Npap60, 1700030K07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18141
VEGA: 15
HGNC: HGNC:8065
Homologene: 5190
Pcnx3
Name: pecanex homolog 3
Synonyms: Pcnxl3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104401
Homologene: 17000
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: 2700049P18Rik, P17
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108900
Homologene: 82352
Slc12a9
Name: solute carrier family 12 (potassium/chloride transporters), member 9
Synonyms: CIP1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83704
Homologene: 5429
Nceh1
Name: neutral cholesterol ester hydrolase 1
Synonyms: CPO-BP, mKIAA1363, B230106I24Rik, Aadacl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320024
Homologene: 23251
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Tbx1
Name: T-box 1
Synonyms: nmf219
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21380
VEGA: 16
Homologene: 7966
Syk
Name: spleen tyrosine kinase
Synonyms: Sykb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20963
Homologene: 2390
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
1700123K08Rik
Name: RIKEN cDNA 1700123K08 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76658
Homologene: 86127
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Kbtbd11
Name: kelch repeat and BTB (POZ) domain containing 11
Synonyms: 4930465M17Rik, 2900016B01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74901
Homologene: 28701
Eif4a3l1
Name: eukaryotic translation initiation factor 4A3 like 1
Synonyms: Gm8994, B020013A22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 668137
Armc12
Name: armadillo repeat containing 12
Synonyms: 4930511I11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67645
Homologene: 12168
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: 5730421J18Rik, 5730538E15Rik, Vcip135
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Myoz3
Name: myozenin 3
Synonyms: calsarcin-3, Fatz-3, 4833419K08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 170947
Homologene: 15782
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Wdr27
Name: WD repeat domain 27
Synonyms: 0610012K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71682
VEGA: 17
Homologene: 18417
Sdr39u1
Name: short chain dehydrogenase/reductase family 39U, member 1
Synonyms: 2310014G06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 654795
VEGA: 14
Homologene: 69295
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: Kiaa0184-hp, 4931420H10Rik, Dip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64451
Homologene: 41012
Frat2
Name: frequently rearranged in advanced T cell lymphomas 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 212398
Homologene: 8095
Cers3
Name: ceramide synthase 3
Synonyms: T3L, related to TRH3, LOC233330, CerS3, 4930550L11Rik, Lass3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545975
Homologene: 18719
Sh2d7
Name: SH2 domain containing 7
Synonyms: 4933412E14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244885
Homologene: 18355
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384724
Homologene: 76639
Cry2
Name: cryptochrome circadian regulator 2
Synonyms: D130054K12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12953
HGNC: HGNC:2385
Homologene: 56466
Hs3st3b1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms: 3OST3B1, HS3ST3B1, 3-OST-3B, m3-OST-3B, 3Ost3b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54710
HGNC: HGNC:5198
Homologene: 88576
Pdzk1
Name: PDZ domain containing 1
Synonyms: mPDZK1, 1700023D20Rik, 4921513F16Rik, 2610507N21Rik, D3Ertd537e, Nherf3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59020
Homologene: 1964
Chmp4c
Name: charged multivesicular body protein 4C
Synonyms: 2210015K02Rik, 2010012P02Rik, 2310010I16Rik, Snf7-3, chromatin modifying protein 4C
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66371
Homologene: 23544
Bola1
Name: bolA family member 1
Synonyms: 1810037G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69168
Homologene: 41103
Crtac1
Name: cartilage acidic protein 1
Synonyms: 2810454P21Rik, Crtac1B, Lotus
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72832
VEGA: 19
Homologene: 23070
Scrn3
Name: secernin 3
Synonyms: 4833415E20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74616
Homologene: 11601
Hbb-bs
Name: hemoglobin, beta adult s chain
Synonyms: beta s
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100503605
Homologene: 68066
Gm43302
Name: predicted gene 43302
Type: Gene
Species: Mouse
Chromosome: 5
Rnf223
Name: ring finger 223
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100045778
Homologene: 27073
Krtap5-22
Name: keratin associated protein 5-22
Synonyms: Krtap5-22, Gm29735
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101055862
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,724,606 bp
  • A to T, chromosome 1 at 131,533,925 bp
  • A to G, chromosome 1 at 176,736,879 bp
  • T to C, chromosome 2 at 52,206,182 bp
  • T to G, chromosome 2 at 73,329,769 bp
  • T to A, chromosome 2 at 76,778,764 bp
  • T to C, chromosome 2 at 92,413,941 bp
  • T to C, chromosome 2 at 120,535,618 bp
  • A to T, chromosome 3 at 10,385,686 bp
  • C to A, chromosome 3 at 27,239,664 bp
  • G to A, chromosome 3 at 88,646,220 bp
  • G to A, chromosome 3 at 96,197,257 bp
  • A to G, chromosome 3 at 96,851,708 bp
  • C to T, chromosome 4 at 12,087,891 bp
  • C to A, chromosome 4 at 63,329,897 bp
  • T to G, chromosome 4 at 156,132,663 bp
  • A to T, chromosome 5 at 73,068,730 bp
  • A to T, chromosome 5 at 104,212,899 bp
  • A to T, chromosome 5 at 105,274,707 bp
  • C to A, chromosome 5 at 137,315,475 bp
  • G to A, chromosome 5 at 138,562,926 bp
  • A to G, chromosome 5 at 143,377,518 bp
  • A to G, chromosome 6 at 73,195,815 bp
  • C to T, chromosome 6 at 136,329,243 bp
  • A to G, chromosome 7 at 27,157,381 bp
  • T to C, chromosome 7 at 66,764,342 bp
  • T to C, chromosome 7 at 103,826,744 bp
  • T to C, chromosome 7 at 131,085,417 bp
  • ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA to ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA, chromosome 7 at 142,156,529 bp
  • G to A, chromosome 8 at 15,028,603 bp
  • T to A, chromosome 9 at 15,915,139 bp
  • A to G, chromosome 9 at 54,540,907 bp
  • T to C, chromosome 9 at 70,125,018 bp
  • G to T, chromosome 10 at 76,264,856 bp
  • T to A, chromosome 10 at 76,535,595 bp
  • G to C, chromosome 11 at 63,889,564 bp
  • T to G, chromosome 11 at 100,349,281 bp
  • T to C, chromosome 11 at 100,576,441 bp
  • A to G, chromosome 11 at 118,087,047 bp
  • C to A, chromosome 12 at 116,363,482 bp
  • T to C, chromosome 13 at 52,620,899 bp
  • T to A, chromosome 13 at 81,435,843 bp
  • T to C, chromosome 14 at 55,897,906 bp
  • T to A, chromosome 14 at 79,645,381 bp
  • T to A, chromosome 15 at 84,935,275 bp
  • A to T, chromosome 15 at 89,299,509 bp
  • A to T, chromosome 16 at 18,582,045 bp
  • T to C, chromosome 16 at 63,652,490 bp
  • T to C, chromosome 17 at 14,932,525 bp
  • T to A, chromosome 17 at 28,532,057 bp
  • T to G, chromosome 17 at 35,848,299 bp
  • T to G, chromosome 18 at 50,164,667 bp
  • T to C, chromosome 18 at 60,579,002 bp
  • T to A, chromosome 19 at 5,673,226 bp
  • T to C, chromosome 19 at 6,246,811 bp
  • C to T, chromosome 19 at 16,654,507 bp
  • A to T, chromosome 19 at 41,847,784 bp
  • G to A, chromosome 19 at 42,309,186 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8450 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067830-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.