Strain Name:
C57BL/6J-MtgxR8468Btlr/Mmmh
Stock Number:
067912-MU
Citation ID:
RRID:MMRRC_067912-MU
Other Names:
R8468 (G1)
Major Collection:

Strain Information

Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Ints3
Name: integrator complex subunit 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229543
Homologene: 11309
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Lgals3
Name: lectin, galactose binding, soluble 3
Synonyms: Mac-2, galectin-3, L-34, gal3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16854
HGNC: HGNC:6563
Homologene: 37608
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
Grk6
Name: G protein-coupled receptor kinase 6
Synonyms: Gprk6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26385
VEGA: 13
HGNC: HGNC:4545
Homologene: 37570
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Pkd2l2
Name: polycystic kidney disease 2-like 2
Synonyms: Polycystin - L2, TRPP5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53871
VEGA: 18
HGNC: HGNC:9012
Homologene: 22812
Fastkd2
Name: FAST kinase domains 2
Synonyms: 2810421I24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75619
Homologene: 8957
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Or5ak24
Name: olfactory receptor family 5 subfamily AK member 24
Synonyms: GA_x6K02T2Q125-46907515-46906571, MOR203-4, Olfr994
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258425
Homologene: 17245
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Sfmbt1
Name: Scm-like with four mbt domains 1
Synonyms: Smr, 4930442N21Rik, 9330180L21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54650
Homologene: 9472
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Ppp1r36
Name: protein phosphatase 1, regulatory subunit 36
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 210762
VEGA: 12
Homologene: 52094
Naaladl1
Name: N-acetylated alpha-linked acidic dipeptidase-like 1
Synonyms: LOC381204
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381204
Homologene: 21124
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Adamts1
Name: ADAM metallopeptidase with thrombospondin type 1 motif 1
Synonyms: ADAM-TS1, METH1, METH-1, ADAMTS-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11504
HGNC: HGNC:217
Homologene: 21381
Cd248
Name: CD248 antigen, endosialin
Synonyms: 2610111G01Rik, Tem1, Cd164l1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70445
VEGA: 19
Homologene: 10699
Miip
Name: migration and invasion inhibitory protein
Synonyms: D4Wsu114e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 28010
Homologene: 15879
Or2ag2b
Name: olfactory receptor family 2 subfamily AG member 2B
Synonyms: 4932441H21Rik, GA_x6K02T2PBJ9-9195805-9196755, MOR283-1, 4933433E02Rik, Olfr701
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66786
Homologene: 12558
Or6c69c
Name: olfactory receptor family 6 subfamily C member 69C
Synonyms: GA_x6K02T2PULF-11745102-11746040, MOR113-2, Olfr822
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258666
Homologene: 133890
Zfp937
Name: zinc finger protein 937
Synonyms: Gm4979
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245174
Homologene: 136215
Sestd1
Name: SEC14 and spectrin domains 1
Synonyms: 1500031J16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228071
Homologene: 45505
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: TCF9, LOC381696, D430033A06Rik, 1700012H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100978
Homologene: 26752
Or56a3b
Name: olfactory receptor family 56 subfamily A member 3B
Synonyms: GA_x6K02T2PBJ9-7750163-7751110, MOR40-14, Olfr681
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404318
Homologene: 81538
Gpr85
Name: G protein-coupled receptor 85
Synonyms: 2900026B03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64450
HGNC: HGNC:4536
Homologene: 10355
Or52e7
Name: olfactory receptor family 52 subfamily E member 7
Synonyms: GA_x6K02T2PBJ9-7664016-7664969, MOR32-1, Olfr676
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259099
Homologene: 64955
Or12e10
Name: olfactory receptor family 12 subfamily E member 10
Synonyms: GA_x6K02T2Q125-49311440-49312384, MOR264-19, Olfr1145
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258317
Homologene: 27123
Gm6665
Name: predicted gene 6665
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 626327
VEGA: 18
Krt33b
Name: keratin 33B
Synonyms: Ha3, Ha4, mHa3, Krt1-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16671
Homologene: 74433
BC035947
Name: cDNA sequence BC035947
Type: Gene
Species: Mouse
Chromosome: 1
Vmn1r12
Name: vomeronasal 1 receptor 12
Synonyms: Gm6674
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 626397
Homologene: 74373
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 63,731,764 bp
  • C to T, chromosome 1 at 75,431,309 bp
  • C to A, chromosome 1 at 78,498,330 bp
  • T to A, chromosome 2 at 77,191,746 bp
  • T to A, chromosome 2 at 85,430,178 bp
  • T to C, chromosome 2 at 87,810,738 bp
  • T to G, chromosome 2 at 150,238,714 bp
  • A to G, chromosome 3 at 90,406,253 bp
  • G to T, chromosome 4 at 147,861,471 bp
  • C to T, chromosome 5 at 72,518,205 bp
  • T to C, chromosome 5 at 84,142,416 bp
  • C to T, chromosome 5 at 89,694,768 bp
  • A to T, chromosome 6 at 13,836,296 bp
  • A to G, chromosome 6 at 57,159,385 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • A to T, chromosome 7 at 105,035,746 bp
  • A to G, chromosome 7 at 105,121,478 bp
  • A to G, chromosome 7 at 106,818,839 bp
  • A to C, chromosome 7 at 144,655,620 bp
  • A to G, chromosome 10 at 39,827,991 bp
  • G to A, chromosome 10 at 127,558,650 bp
  • G to A, chromosome 10 at 128,484,393 bp
  • C to T, chromosome 10 at 130,074,434 bp
  • C to A, chromosome 11 at 65,831,730 bp
  • T to A, chromosome 11 at 83,351,065 bp
  • G to A, chromosome 11 at 100,029,789 bp
  • A to G, chromosome 12 at 76,436,205 bp
  • T to C, chromosome 12 at 78,226,827 bp
  • A to G, chromosome 13 at 55,451,385 bp
  • A to G, chromosome 13 at 100,060,568 bp
  • G to A, chromosome 14 at 30,773,984 bp
  • A to G, chromosome 14 at 47,381,647 bp
  • A to G, chromosome 16 at 85,795,556 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • T to C, chromosome 18 at 31,820,400 bp
  • A to G, chromosome 18 at 34,427,411 bp
  • T to A, chromosome 19 at 5,069,882 bp
  • T to A, chromosome 19 at 6,108,585 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8468 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067912-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.