Strain Name:
B6.Cg-Gt(ROSA)26Sorem2(CAG-tdTomato)Jahe/Mmjax
Stock Number:
068228-JAX
Citation ID:
RRID:MMRRC_068228-JAX
Other Names:

B6.Cg-Gt(ROSA)26Sorem2(CAG-tdTomato)Jahe; Ai9-Cas12a; NCFP

Strain Information

Gt(ROSA)26Sorem2(CAG-tdTomato)Jahe
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 2, Jason Heaney
Synonyms: Ai9-Cas12a
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: CRISPR
CAG
Name: CMV early enhancer/chicken beta actin promoter/rabbit beta globin splice acceptor
Type: DNA Segment
Species: Multi-species
Chromosome:
Alteration at locus: CRISPR
Gt(ROSA)26Sor
Name: gene trap ROSA 26, Philippe Soriano
Synonyms: ROSA26, beta geo, Gtrgeo26, Gtrosa26, R26, Thumpd3as1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: CRISPR
NCBI: 14910
tdTomato
Name:
Type: Gene
Species: Discosoma sp. (mushroom coral)
Chromosome:
Alteration at locus: CRISPR
Genetic Alterations

CRISPR/Cas9 genome-editing was used to modify embryos from B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (RRID:IMSR_JAX:007909 - "Ai9"). Guide target sequences for Acidaminococcus sp., and Lachnospiraceae sp. Cas12a found on the 5' end of the loxP-flanked stop cassette [5'(PAM TTTG) GCAAAGAATTGATTTGATACCGC] are duplicated onto the 3' end of the stop cassette. The modification of Ai9 leads to the partial deletion of the loxP site on the 3' end of the stop cassette.

Phenotype

Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9; RRID:IMSR_JAX:007909) was modified to duplicate the guide target sequences for Acidaminococcus sp. and Lachnospiraceae sp. cas12a found on the 5' end of the loxP-flanked stop cassette onto the 3' end of the stop cassette. With this modification, a single guide RNA for Acidaminococcus sp. or Lachnospiraceae sp. cas12a can be used to mediate deletion of the stop cassette by non-homologous end-joining to activate tdTomato expression. The donating investigator indicates that it is believed that the remaining sequence is not sufficient for cre-mediated recombination with the 5' loxP site.

Mice homozygous for Ai9-Cas12a or NCFP are viable and fertile. Tint from the fluorochromes may be visually apparent on furless skin.

Strain Development

CRISPR/Cas9 genome-editing was used (as specified above). Founder mice with the Ai9-Cas12a allele were identified by PCR and sequencing. Founders were bred to C57BL/6J mice for germline transmission further backcrossed to C57BL/6J for an additional 3 generations. The strain was then bred to homozygosity. Upon arrival, mice were bred to C57BL/6J for at least 1 generation to establish the colony.

Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Research Tools
Donor
Jason Heaney, Ph.D., Baylor College of Medicine.
Primary Reference
Publication neither planned nor in preparation

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross and sib-mating
Generation

N5 (C57BL/6J), F? (to homozygosity)

Overall Breeding Performance
Undetermined
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068228-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
068228-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.