Strain Name:
C57BL/6J-MtgxR8530Btlr/Mmmh
Stock Number:
068500-MU
Citation ID:
RRID:MMRRC_068500-MU
Other Names:
R8530 (G1)
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Dbh
Name: dopamine beta hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13166
HGNC: HGNC:2689
Homologene: 615
Eif3g
Name: eukaryotic translation initiation factor 3, subunit G
Synonyms: TU-189B2, p44, 44kDa, D0Jmb4, Eif3s4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53356
VEGA: 9
HGNC: HGNC:3274
Homologene: 2784
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
E2f7
Name: E2F transcription factor 7
Synonyms: A630014C11Rik, E2F7, D10Ertd739e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52679
Homologene: 18685
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Wars1
Name: tryptophanyl-tRNA synthetase1
Synonyms: Wars
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22375
Homologene: 3084
Car14
Name: carbonic anhydrase 14
Synonyms: CA XIV
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23831
HGNC: HGNC:1372
Homologene: 69105
Qtrt2
Name: queuine tRNA-ribosyltransferase accessory subunit 2
Synonyms: 3110012M05Rik, 4930470H18Rik, Qrtr2, Qtrtd1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106248
Homologene: 41576
Ank
Name: progressive ankylosis
Synonyms: D15Ertd221e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11732
Homologene: 10664
Hps6
Name: HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms: ruby eye, ru, 5330434M19Rik, BLOC-2, Hermansky-Pudlak syndrome 6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20170
VEGA: 19
Homologene: 11691
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Cfi
Name: complement component factor i
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12630
HGNC: HGNC:5394
Homologene: 171
Adam20
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384806
HGNC: HGNC:199
Homologene: 128364
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Fyco1
Name: FYVE and coiled-coil domain containing 1
Synonyms: Mem2, 2810409M01Rik, ZFYVE7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17281
Homologene: 11561
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Fa2h
Name: fatty acid 2-hydroxylase
Synonyms: G630055L08Rik, Faxdc1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 338521
Homologene: 56284
1110002E22Rik
Name: RIKEN cDNA 1110002E22 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102634333
Homologene: 131709
Zfp120
Name: zinc finger protein 120
Synonyms: MZF31, E030042N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104348
Homologene: 138454
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Gcc1
Name: golgi coiled coil 1
Synonyms: 4932417P04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74375
Homologene: 11567
4930407I10Rik
Name: RIKEN cDNA 4930407I10 gene
Synonyms: LOC328573
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328573
VEGA: 15
Homologene: 130065
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Vmn2r58
Name: vomeronasal 2, receptor 58
Synonyms: EG628422
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628422
Rhof
Name: ras homolog family member F (in filopodia)
Synonyms: Ifld1, Arhf
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23912
Homologene: 41304
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Matn1
Name: matrilin 1, cartilage matrix protein
Synonyms: matrilin-1, CMP, Crtm, Mat1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17180
HGNC: HGNC:6907
Homologene: 1783
Gabrb3
Name: GABRB3, gamma-aminobutyric acid type A receptor subunit beta 3
Synonyms: Gabrb-3, A230092K12Rik, beta3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14402
HGNC: HGNC:4083
Homologene: 633
Bcas1
Name: brain enriched myelin associated protein 1
Synonyms: NABC1, 2210416M21Rik, 9030223A09Rik, breast carcinoma amplified sequence 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76960
HGNC: HGNC:974
Homologene: 2714
Pcare
Name: photoreceptor cilium actin regulator
Synonyms: BC027072
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225004
VEGA: 17
Homologene: 19792
Foxc1
Name: forkhead box C1
Synonyms: frkhda, fkh1, fkh-1, FREAC3, Fkh1, Mf1, Mf4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17300
HGNC: HGNC:3800
Homologene: 20373
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, T1r2, Gpr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83770
Homologene: 75323
Or5d43
Name: olfactory receptor family 5 subfamily D member 43
Synonyms: GA_x6K02T2Q125-49759783-49758845, MOR174-20_p, Olfr1173
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404329
Homologene: 128091
Cd163
Name: CD163 antigen
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93671
HGNC: HGNC:1631
Homologene: 128811
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Uck1
Name: uridine-cytidine kinase 1
Synonyms: URK1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22245
Homologene: 7990
Akr1c12
Name: aldo-keto reductase family 1, member C12
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 622402
HGNC: HGNC:387
Homologene: 121208
Or6d12
Name: olfactory receptor family 6 subfamily D member 12
Synonyms: GA_x54KRFPKN04-58149882-58150865, MOR119-4, 4931403F16Rik, Olfr212
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258019
Homologene: 74186
Tlx1
Name: T cell leukemia, homeobox 1
Synonyms: Hox11, Hox-11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21908
HGNC: HGNC:5056
Homologene: 4031
Phactr3
Name: phosphatase and actin regulator 3
Synonyms: scapinin, 1500003N10Rik, 4930415A02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74189
Homologene: 14482
Spata31d1b
Name: spermatogenesis associated 31 subfamily D, member 1B
Synonyms: Fam75d1b, Gm4934
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238662
VEGA: 13
Potefam3a
Name: POTE ankyrin domain family member 3A
Synonyms: Pote3a, Gm15319, Poteb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100040599
Homologene: 128726
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 181,664,946 bp
  • A to G, chromosome 2 at 27,168,306 bp
  • C to A, chromosome 2 at 31,391,076 bp
  • C to A, chromosome 2 at 32,260,141 bp
  • A to T, chromosome 2 at 88,274,810 bp
  • A to G, chromosome 2 at 150,117,248 bp
  • A to T, chromosome 2 at 170,387,948 bp
  • A to G, chromosome 2 at 178,284,026 bp
  • T to C, chromosome 3 at 95,900,358 bp
  • C to T, chromosome 3 at 129,850,733 bp
  • G to C, chromosome 3 at 138,068,825 bp
  • A to T, chromosome 4 at 130,950,136 bp
  • A to T, chromosome 4 at 139,662,149 bp
  • T to A, chromosome 5 at 123,119,518 bp
  • C to A, chromosome 6 at 28,420,731 bp
  • C to G, chromosome 6 at 91,076,645 bp
  • T to A, chromosome 6 at 116,516,569 bp
  • T to C, chromosome 6 at 124,318,901 bp
  • A to T, chromosome 7 at 41,864,152 bp
  • T to C, chromosome 7 at 57,812,071 bp
  • T to C, chromosome 8 at 20,356,984 bp
  • A to T, chromosome 8 at 33,280,824 bp
  • A to G, chromosome 8 at 40,796,034 bp
  • A to T, chromosome 8 at 70,788,233 bp
  • T to C, chromosome 8 at 84,612,414 bp
  • G to A, chromosome 8 at 102,664,755 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 8 at 111,356,156 bp
  • A to C, chromosome 9 at 20,897,730 bp
  • G to T, chromosome 9 at 57,131,638 bp
  • T to A, chromosome 9 at 66,418,628 bp
  • T to A, chromosome 9 at 106,080,505 bp
  • A to G, chromosome 9 at 123,840,540 bp
  • T to C, chromosome 10 at 11,151,934 bp
  • G to A, chromosome 10 at 76,420,205 bp
  • T to A, chromosome 10 at 110,778,998 bp
  • A to T, chromosome 11 at 70,919,242 bp
  • A to T, chromosome 12 at 101,651,185 bp
  • G to A, chromosome 12 at 108,882,892 bp
  • A to T, chromosome 12 at 119,445,739 bp
  • A to T, chromosome 13 at 4,270,161 bp
  • C to A, chromosome 13 at 31,807,788 bp
  • A to T, chromosome 13 at 59,717,150 bp
  • G to A, chromosome 15 at 27,544,404 bp
  • T to A, chromosome 15 at 82,065,386 bp
  • C to A, chromosome 16 at 43,869,044 bp
  • G to T, chromosome 17 at 3,450,812 bp
  • T to C, chromosome 17 at 71,752,106 bp
  • A to T, chromosome 19 at 45,151,085 bp
  • A to T, chromosome 19 at 46,003,520 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8530 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068500-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.