Strain Name:
C57BL/6J-MtgxR8684Btlr/Mmmh
Stock Number:
068539-MU
Citation ID:
RRID:MMRRC_068539-MU
Other Names:
R8684 (G1)
Major Collection:

Strain Information

Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Cep70
Name: centrosomal protein 70
Synonyms: 6720484E09Rik, C030018L16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68121
Homologene: 11387
Trmo
Name: tRNA methyltransferase O
Synonyms: 5830415F09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74753
Homologene: 32316
Dnajc11
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230935
Homologene: 14558
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Zfp101
Name: zinc finger protein 101
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22643
Homologene: 137226
Sulf1
Name: sulfatase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240725
Homologene: 49408
Fancl
Name: Fanconi anemia, complementation group L
Synonyms: 2010322C19Rik, gcd, Pog, Phf9, B230118H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67030
Homologene: 9987
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Traf2
Name: TNF receptor-associated factor 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22030
Homologene: 22520
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Sox2
Name: SRY (sex determining region Y)-box 2
Synonyms: Sox-2, lcc, ysb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20674
Homologene: 68298
Pah
Name: phenylalanine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18478
HGNC: HGNC:8582
Homologene: 234
Lingo1
Name: leucine rich repeat and Ig domain containing 1
Synonyms: UNQ201, LERN1, 4930471K13Rik, LINGO-1, Lrrn6a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235402
Homologene: 41891
Nup88
Name: nucleoporin 88
Synonyms: Nup84, Prei2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19069
HGNC: HGNC:8067
Homologene: 1901
Ttyh1
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57776
Homologene: 10779
Rasgef1b
Name: RasGEF domain family, member 1B
Synonyms: Gpig4, 4732452O09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320292
Homologene: 14860
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Spink5
Name: serine peptidase inhibitor, Kazal type 5
Synonyms: LEKT1, 2310065D10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72432
Homologene: 4987
Eci3
Name: enoyl-Coenzyme A delta isomerase 3
Synonyms: 1810022C23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69123
Homologene: 74357
Adamts4
Name: ADAM metallopeptidase with thrombospondin type 1 motif 4
Synonyms: aggrecanase-1, ADAM-TS4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240913
HGNC: HGNC:220
Homologene: 36169
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, 1700047E16Rik, fantom, Nphp8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Cdcp3
Name: CUB domain containing protein 3
Synonyms: 5430419D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71395
Homologene: 138430
Gm10801
Name: predicted gene 10801
Type: Gene
Species: Mouse
Chromosome: 2
Nrp1
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Ror2
Name: receptor tyrosine kinase-like orphan receptor 2
Synonyms: Ntrkr2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26564
Homologene: 55831
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: Abc2, D2H0S1474E
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
AY358078
Name: cDNA sequence AY358078
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 278676
Homologene: 115686
Mmp13
Name: matrix metallopeptidase 13
Synonyms: interstitial collagenase, Collagenase-3, collagenase-1, Clg, Mmp1, MMP-13
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17386
VEGA: 9
HGNC: HGNC:7159
Homologene: 20548
Coro1b
Name: coronin, actin binding protein 1B
Synonyms: coronin 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23789
HGNC: HGNC:2253
Homologene: 40790
Or7a36
Name: olfactory receptor family 7 subfamily A member 36
Synonyms: GA_x6K02T2QGN0-2828447-2827518, MOR139-1, Olfr1352
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259074
Homologene: 131141
Smco1
Name: single-pass membrane protein with coiled-coil domains 1
Synonyms: 2310010M20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69576
Homologene: 18842
Loxl3
Name: lysyl oxidase-like 3
Synonyms: Lor2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16950
Homologene: 56591
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: A230107C01Rik, Catsperg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Vmn2r45
Name: vomeronasal 2, receptor 45
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042810
Homologene: 113703
Peli3
Name: pellino 3
Synonyms: 6030441F14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240518
Homologene: 27059
Lce1e
Name: late cornified envelope 1E
Synonyms: 1110031B11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68694
4933421I07Rik
Name: RIKEN cDNA 4933421I07 gene
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71162
Homologene: 86127
Or2r11
Name: olfactory receptor family 2 subfamily R member 11
Synonyms: GA_x6K02T2P3E9-5100053-5100994, MOR257-4, Olfr458
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258436
Homologene: 133704
Or5d39
Name: olfactory receptor family 5 subfamily D member 39
Synonyms: GA_x6K02T2Q125-49641892-49640942, MOR174-16, Olfr1167
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258291
Homologene: 138307
Trav13d-4
Name: T cell receptor alpha variable 13D-4
Synonyms: Gm17006
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 639655
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 12,796,780 bp
  • T to A, chromosome 1 at 164,217,542 bp
  • A to T, chromosome 1 at 171,258,972 bp
  • A to G, chromosome 1 at 188,911,023 bp
  • T to A, chromosome 2 at 25,446,496 bp
  • A to G, chromosome 2 at 25,520,446 bp
  • T to C, chromosome 2 at 88,149,528 bp
  • ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC to ATTTTCAGTTTTC, chromosome 2 at 98,662,324 bp
  • T to A, chromosome 3 at 34,650,867 bp
  • A to T, chromosome 3 at 92,707,962 bp
  • T to C, chromosome 3 at 104,804,374 bp
  • C to T, chromosome 4 at 46,386,251 bp
  • T to C, chromosome 4 at 46,386,253 bp
  • T to C, chromosome 4 at 151,980,726 bp
  • A to T, chromosome 5 at 99,377,135 bp
  • T to C, chromosome 6 at 42,460,893 bp
  • A to G, chromosome 6 at 58,887,576 bp
  • A to G, chromosome 6 at 83,035,585 bp
  • T to A, chromosome 7 at 4,130,792 bp
  • T to C, chromosome 7 at 8,483,512 bp
  • C to T, chromosome 7 at 29,198,400 bp
  • C to T, chromosome 7 at 42,447,989 bp
  • C to A, chromosome 7 at 131,235,959 bp
  • T to G, chromosome 8 at 91,273,701 bp
  • C to T, chromosome 8 at 128,359,404 bp
  • A to G, chromosome 9 at 7,282,089 bp
  • T to C, chromosome 9 at 56,620,822 bp
  • A to G, chromosome 9 at 99,263,789 bp
  • A to T, chromosome 10 at 78,984,378 bp
  • A to G, chromosome 10 at 87,578,965 bp
  • C to A, chromosome 11 at 26,470,826 bp
  • C to A, chromosome 11 at 70,969,861 bp
  • T to C, chromosome 11 at 102,205,321 bp
  • A to G, chromosome 12 at 13,336,367 bp
  • A to T, chromosome 13 at 11,687,989 bp
  • T to C, chromosome 13 at 34,959,891 bp
  • T to C, chromosome 13 at 53,110,266 bp
  • T to G, chromosome 14 at 51,822,140 bp
  • T to C, chromosome 14 at 53,072,809 bp
  • A to T, chromosome 16 at 32,274,023 bp
  • C to T, chromosome 16 at 36,914,402 bp
  • T to A, chromosome 17 at 18,277,650 bp
  • A to G, chromosome 17 at 33,382,003 bp
  • A to G, chromosome 18 at 44,010,238 bp
  • T to A, chromosome 19 at 4,149,528 bp
  • T to C, chromosome 19 at 4,934,994 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • C to T, chromosome X at 101,319,819 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8684 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068539-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.