Strain Name:
C57BL/6J-MtgxR8853Btlr/Mmmh
Stock Number:
068675-MU
Citation ID:
RRID:MMRRC_068675-MU
Other Names:
R8853 (G1)
Major Collection:

Strain Information

Rasgrp2
Name: RAS, guanyl releasing protein 2
Synonyms: CalDAG-GEFI, Caldaggef1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19395
HGNC: HGNC:9879
Homologene: 4250
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Elp3
Name: elongator acetyltransferase complex subunit 3
Synonyms: 2610507P14Rik, KAT9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74195
VEGA: 14
Homologene: 7105
Ndnf
Name: neuron-derived neurotrophic factor
Synonyms: epidermacan, A930038C07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68169
Homologene: 11593
Pvr
Name: poliovirus receptor
Synonyms: mE4, 3830421F03Rik, Taa1, CD155, Tage4, necl-5, D7Ertd458e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52118
HGNC: HGNC:9705
Homologene: 79541
Eif3b
Name: eukaryotic translation initiation factor 3, subunit B
Synonyms: EIF3-P116, D5Wsu45e, Eif3s9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27979
HGNC: HGNC:3280
Homologene: 2780
Rnf34
Name: ring finger protein 34
Synonyms: phafin 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80751
Homologene: 11839
Ap5m1
Name: adaptor-related protein complex 5, mu 1 subunit
Synonyms: 4932432K03Rik, Mudeng
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74385
VEGA: 14
Homologene: 10081
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: NMHC II-C, 2400004E04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71960
Homologene: 23480
Pfas
Name: phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms: 4432409B16Rik, Sofa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237823
HGNC: HGNC:8863
Homologene: 5970
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Egfr
Name: epidermal growth factor receptor
Synonyms: avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Wa5, 9030024J15Rik, Errb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Nfix
Name: nuclear factor I/X
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18032
HGNC: HGNC:7788
Homologene: 1872
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Reck
Name: reversion-inducing-cysteine-rich protein with kazal motifs
Synonyms: St15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53614
Homologene: 9622
Copg2
Name: coatomer protein complex, subunit gamma 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54160
HGNC: HGNC:2237
Homologene: 56292
Zmynd11
Name: zinc finger, MYND domain containing 11
Synonyms: 2210402G22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66505
Homologene: 4828
Eea1
Name: early endosome antigen 1
Synonyms: B230358H09Rik, ZFYVE2, A430109M19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216238
VEGA: 10
HGNC: HGNC:3185
Homologene: 37822
Ppp1r13l
Name: protein phosphatase 1, regulatory subunit 13 like
Synonyms: NFkB interacting protein 1, wa3, IASPP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 333654
Homologene: 84635
Trhde
Name: TRH-degrading enzyme
Synonyms: 9330155P21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237553
Homologene: 75007
Atp6v1c2
Name: ATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms: 1110038G14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68775
Homologene: 15866
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: dunce, Dpde2, D9Ertd60e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Ern2
Name: endoplasmic reticulum to nucleus signalling 2
Synonyms: Ire1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26918
Homologene: 22687
Rap1gap2
Name: RAP1 GTPase activating protein 2
Synonyms: LOC380710, Garnl4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380711
Homologene: 56695
Klhl6
Name: kelch-like 6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239743
Homologene: 15603
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Trappc11
Name: trafficking protein particle complex 11
Synonyms: D030016E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320714
Homologene: 11076
Or6k14
Name: olfactory receptor family 6 subfamily K member 14
Synonyms: GA_x6K02T2P20D-21075927-21074980, MOR105-9, MOR105-7, Olfr427, MOR105-13_p, MOR105-8, GA_x6K02T2P20D-21063569-21062619, Olfr426
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 259162
Homologene: 133035
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 4632403N06Rik, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17922
HGNC: HGNC:7607
Homologene: 81947
Peli2
Name: pellino 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93834
VEGA: 14
HGNC: HGNC:8828
Homologene: 41431
Cyp2b19
Name: cytochrome P450, family 2, subfamily b, polypeptide 19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13090
HGNC: HGNC:2615
Homologene: 104114
Synpo2l
Name: synaptopodin 2-like
Synonyms: 1110054M18Rik, Chap
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68760
Homologene: 23499
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Aoc1
Name: amine oxidase, copper-containing 1
Synonyms: 1600012D06Rik, Abp1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76507
HGNC: HGNC:80
Homologene: 68159
Vmn2r53
Name: vomeronasal 2, receptor 53
Synonyms: EG637908
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637908
Homologene: 104040
Plcl2
Name: phospholipase C-like 2
Synonyms: Plce2, PRIP-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224860
VEGA: 17
HGNC: HGNC:9064
Homologene: 9052
Serpina3m
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3M
Synonyms: contrapsin-like, Spi-2rs1, Spi-2l, Spi2-rs1, MMSPi2.4, Spi2.4, MMCM7, 3e46, antitrypsin, alpha-1 antiproteinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20717
HGNC: HGNC:16
Homologene: 111129
Vmn2r54
Name: vomeronasal 2, receptor 54
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666085
Homologene: 104040
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23968
Homologene: 65105
Evc
Name: EvC ciliary complex subunit 1
Synonyms: Ellis van Creveld gene syndrome
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59056
HGNC: HGNC:3497
Homologene: 10949
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Dlgap3
Name: DLG associated protein 3
Synonyms: PSD-95/SAP90-binding protein 3, SAP90/PSD 95 associated protein 3, DAP3, Sapap3, Prpl8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242667
Homologene: 18276
Necab2
Name: N-terminal EF-hand calcium binding protein 2
Synonyms: Necab2, Efcbp2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 117148
Homologene: 62200
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381759
Homologene: 52392
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Nfatc4
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms: 3110041H08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73181
VEGA: 14
HGNC: HGNC:7778
Homologene: 3349
Spred3
Name: sprouty-related EVH1 domain containing 3
Synonyms: Spred-3, D130060H24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101809
Homologene: 28061
Myrip
Name: myosin VIIA and Rab interacting protein
Synonyms: Slac2-c, A230081N12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245049
Homologene: 9150
Zfp112
Name: zinc finger protein 112
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57745
Homologene: 49338
Glt28d2
Name: glycosyltransferase 28 domain containing 2
Synonyms: 4732486J07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320302
Homologene: 44843
Zfp40
Name: zinc finger protein 40
Synonyms: NTfin12, Zfp-40
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22700
Homologene: 136312
Tex261
Name: testis expressed gene 261
Synonyms: TEG-261, 3110001O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21766
Homologene: 6131
Defb35
Name: defensin beta 35
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 246084
Sult2a7
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 7
Synonyms: Gm7231
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 638251
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,073,455 bp
  • A to T, chromosome 1 at 150,671,975 bp
  • T to C, chromosome 1 at 174,100,295 bp
  • G to T, chromosome 2 at 145,876,555 bp
  • T to C, chromosome 3 at 63,781,546 bp
  • T to A, chromosome 3 at 85,871,780 bp
  • T to A, chromosome 4 at 43,912,089 bp
  • T to A, chromosome 4 at 127,195,017 bp
  • A to T, chromosome 5 at 36,629,680 bp
  • G to A, chromosome 5 at 37,303,303 bp
  • T to C, chromosome 5 at 122,864,024 bp
  • G to A, chromosome 5 at 140,440,019 bp
  • G to C, chromosome 6 at 30,826,180 bp
  • A to G, chromosome 6 at 40,464,266 bp
  • A to T, chromosome 6 at 48,906,060 bp
  • C to A, chromosome 6 at 65,703,177 bp
  • A to T, chromosome 6 at 83,773,745 bp
  • G to A, chromosome 6 at 125,657,264 bp
  • A to T, chromosome 7 at 12,581,810 bp
  • A to T, chromosome 7 at 12,615,855 bp
  • A to G, chromosome 7 at 14,491,716 bp
  • A to G, chromosome 7 at 19,369,968 bp
  • A to G, chromosome 7 at 19,916,972 bp
  • A to T, chromosome 7 at 23,418,300 bp
  • A to T, chromosome 7 at 24,123,965 bp
  • A to G, chromosome 7 at 26,757,220 bp
  • A to G, chromosome 7 at 29,161,990 bp
  • G to A, chromosome 7 at 44,616,254 bp
  • A to G, chromosome 7 at 122,173,744 bp
  • G to A, chromosome 8 at 21,940,790 bp
  • A to G, chromosome 8 at 47,529,404 bp
  • A to G, chromosome 8 at 48,342,347 bp
  • A to G, chromosome 8 at 84,727,647 bp
  • C to G, chromosome 8 at 119,462,600 bp
  • A to T, chromosome 9 at 7,117,645 bp
  • A to G, chromosome 9 at 21,194,823 bp
  • A to G, chromosome 9 at 101,212,911 bp
  • T to G, chromosome 9 at 112,147,448 bp
  • C to T, chromosome 9 at 120,461,421 bp
  • G to C, chromosome 10 at 96,021,655 bp
  • G to A, chromosome 10 at 114,800,925 bp
  • A to G, chromosome 11 at 16,908,885 bp
  • T to C, chromosome 11 at 68,992,918 bp
  • A to G, chromosome 11 at 74,407,372 bp
  • C to T, chromosome 12 at 17,301,147 bp
  • A to G, chromosome 12 at 104,389,655 bp
  • T to C, chromosome 13 at 9,690,929 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 13 at 117,975,733 bp
  • C to A, chromosome 14 at 20,661,374 bp
  • C to T, chromosome 14 at 48,256,488 bp
  • T to A, chromosome 14 at 49,073,880 bp
  • T to C, chromosome 14 at 55,826,233 bp
  • T to A, chromosome 14 at 65,577,941 bp
  • T to A, chromosome 16 at 19,947,229 bp
  • T to A, chromosome 17 at 23,175,717 bp
  • A to G, chromosome 17 at 34,729,905 bp
  • A to T, chromosome 17 at 50,606,856 bp
  • A to G, chromosome 18 at 31,986,691 bp
  • A to G, chromosome 19 at 6,414,825 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8853 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068675-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.