Strain Name:
C57BL/6J-MtgxR8915Btlr/Mmmh
Stock Number:
068703-MU
Citation ID:
RRID:MMRRC_068703-MU
Other Names:
R8915 (G1)
Major Collection:

Strain Information

Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Rnd1
Name: Rho family GTPase 1
Synonyms: Arhs, A830014L09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223881
Homologene: 8706
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: Pp4r1, 3110001J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Trip13
Name: thyroid hormone receptor interactor 13
Synonyms: 2410002G23Rik, D13Ertd328e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69716
Homologene: 3125
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Fto
Name: FTO alpha-ketoglutarate dependent dioxygenase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26383
Homologene: 8053
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Rbm34
Name: RNA binding motif protein 34
Synonyms: 4930547K05Rik, D8Ertd233e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52202
Homologene: 56691
Gcfc2
Name: GC-rich sequence DNA binding factor 2
Synonyms: AW146020
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330361
HGNC: HGNC:1317
Homologene: 2411
Dnajc10
Name: DnaJ heat shock protein family (Hsp40) member C10
Synonyms: JPDI, 1200006L06Rik, D2Ertd706e, ERdj5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66861
Homologene: 10358
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, 2610524E03Rik, YR-23, D1Bwg0491e, Neg, Rw1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Clec1b
Name: C-type lectin domain family 1, member b
Synonyms: Clec-2, 1810061I13Rik, Clec2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56760
Homologene: 49468
Hsd17b11
Name: hydroxysteroid (17-beta) dehydrogenase 11
Synonyms: Pan1b, retSDR2, Dhrs8, 17beta-HSD11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114664
Homologene: 69209
Pigk
Name: phosphatidylinositol glycan anchor biosynthesis, class K
Synonyms: 3000001O05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329777
HGNC: HGNC:8965
Homologene: 4002
Pard6g
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Zfp574
Name: zinc finger protein 574
Synonyms: A630056B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232976
Homologene: 11238
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Scin
Name: scinderin
Synonyms: adseverin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20259
Homologene: 36296
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Aste1
Name: asteroid homolog 1
Synonyms: 1100001A21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66595
Homologene: 130666
Serpina3j
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3J
Synonyms: alpha-1 antiproteinase, Gm4931
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238395
HGNC: HGNC:16
Homologene: 120222
Cdhr2
Name: cadherin-related family member 2
Synonyms: LOC268663, Pcdh24
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Cdh24
Name: cadherin-like 24
Synonyms: cadherin 14-like, EY-cadherin, 1700040A22Rik, ENSMUSG00000022188
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239096
VEGA: 14
Homologene: 56951
Zfp944
Name: zinc finger protein 944
Synonyms: 6330416L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319615
VEGA: 17
Homologene: 133237
Sh3bp4
Name: SH3-domain binding protein 4
Synonyms: BOG25
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98402
Homologene: 8726
Ctbs
Name: chitobiase
Synonyms: 2210401K11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74245
HGNC: HGNC:2496
Homologene: 3231
Oas2
Name: 2'-5' oligoadenylate synthetase 2
Synonyms: 2'-5' oligoadenylate synthetase-like 11, Oasl11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246728
HGNC: HGNC:8087
Homologene: 49478
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Cyp2c40
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13099
Homologene: 74936
Epb42
Name: erythrocyte membrane protein band 4.2
Synonyms: Epb4.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13828
HGNC: HGNC:3381
Homologene: 93
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: SNS2, NaN, NaT, NSS2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Ncoa5
Name: nuclear receptor coactivator 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228869
Homologene: 32496
Hhat
Name: hedgehog acyltransferase
Synonyms: Skn, 2810432O22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226861
Homologene: 41232
Gpam
Name: glycerol-3-phosphate acyltransferase, mitochondrial
Synonyms: GPAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14732
Homologene: 7343
Foxb2
Name: forkhead box B2
Synonyms: Fkh4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14240
VEGA: 19
Homologene: 136311
Bmp4
Name: bone morphogenetic protein 4
Synonyms: Bmp2b, Bmp2b1, Bmp2b-1, Bmp-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12159
HGNC: HGNC:1071
Homologene: 7247
Acp4
Name: acid phosphatase 4
Synonyms: EG546967, Acpt
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100503991
Homologene: 57200
Calhm5
Name: calcium homeostasis modulator family member 5
Synonyms: Fam26e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103511
VEGA: 10
Homologene: 17807
Vmn2r44
Name: vomeronasal 2, receptor 44
Synonyms: EG434113
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434113
Homologene: 113703
Lactbl1
Name: lactamase, beta-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242707
Homologene: 82492
Samd14
Name: sterile alpha motif domain containing 14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217125
Homologene: 17130
Nfkbie
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, epsilon
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18037
VEGA: 17
HGNC: HGNC:7799
Homologene: 36160
Scrn3
Name: secernin 3
Synonyms: 4833415E20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74616
Homologene: 11601
Or52e2
Name: olfactory receptor family 52 subfamily E member 2
Synonyms: GA_x6K02T2PBJ9-5871256-5870303, MOR32-3, Olfr589
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259054
Homologene: 133046
Nim1k
Name: NIM1 serine/threonine protein kinase
Synonyms: E130304F04Rik, Nim1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 245269
VEGA: 13
Homologene: 25286
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Vmn1r114
Name: vomeronasal 1 receptor 114
Synonyms: Gm10669
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042996
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 36,829,577 bp
  • T to C, chromosome 1 at 43,977,255 bp
  • C to A, chromosome 1 at 89,152,342 bp
  • C to T, chromosome 1 at 192,594,895 bp
  • T to A, chromosome 2 at 73,318,292 bp
  • T to A, chromosome 2 at 80,317,457 bp
  • T to C, chromosome 2 at 121,019,506 bp
  • T to C, chromosome 2 at 165,013,007 bp
  • T to C, chromosome 3 at 146,463,969 bp
  • G to A, chromosome 3 at 152,766,461 bp
  • G to T, chromosome 4 at 136,632,932 bp
  • T to C, chromosome 5 at 103,992,936 bp
  • T to C, chromosome 5 at 120,738,384 bp
  • A to G, chromosome 6 at 81,941,366 bp
  • A to G, chromosome 6 at 84,179,754 bp
  • T to C, chromosome 6 at 129,405,249 bp
  • A to G, chromosome 7 at 8,367,651 bp
  • A to T, chromosome 7 at 20,811,246 bp
  • T to C, chromosome 7 at 25,081,344 bp
  • T to A, chromosome 7 at 44,254,327 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • C to T, chromosome 7 at 103,155,204 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • T to C, chromosome 8 at 91,409,843 bp
  • A to G, chromosome 8 at 126,953,158 bp
  • T to C, chromosome 9 at 66,411,174 bp
  • G to A, chromosome 9 at 105,396,681 bp
  • C to T, chromosome 9 at 119,774,297 bp
  • T to C, chromosome 10 at 34,092,419 bp
  • C to T, chromosome 10 at 52,101,709 bp
  • A to C, chromosome 11 at 95,021,201 bp
  • T to C, chromosome 12 at 40,073,433 bp
  • A to G, chromosome 12 at 104,315,050 bp
  • A to G, chromosome 13 at 24,141,726 bp
  • G to T, chromosome 13 at 54,726,371 bp
  • T to C, chromosome 13 at 73,932,966 bp
  • C to T, chromosome 13 at 81,567,439 bp
  • T to A, chromosome 13 at 119,712,338 bp
  • T to A, chromosome 14 at 46,384,445 bp
  • T to C, chromosome 14 at 54,639,155 bp
  • C to T, chromosome 15 at 56,668,489 bp
  • A to G, chromosome 15 at 98,677,300 bp
  • A to T, chromosome 17 at 22,339,526 bp
  • A to G, chromosome 17 at 45,560,141 bp
  • T to C, chromosome 17 at 65,829,381 bp
  • T to A, chromosome 18 at 22,524,706 bp
  • T to C, chromosome 18 at 80,117,742 bp
  • T to C, chromosome 19 at 16,873,594 bp
  • A to T, chromosome 19 at 39,807,547 bp
  • A to G, chromosome 19 at 55,088,880 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8915 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068703-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.