Strain Name:
C57BL/6J-MtgxR9059Btlr/Mmmh
Stock Number:
068885-MU
Citation ID:
RRID:MMRRC_068885-MU
Other Names:
R9059 (G1)
Major Collection:

Strain Information

Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22036
Homologene: 31343
U2surp
Name: U2 snRNP-associated SURP domain containing
Synonyms: 2610101N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67958
Homologene: 13964
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Diaph1
Name: diaphanous related formin 1
Synonyms: p140mDia, Drf1, Dia1, D18Wsu154e, mDia1, Diap1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13367
HGNC: HGNC:2876
Homologene: 129567
Sec23ip
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Larp4
Name: La ribonucleoprotein 4
Synonyms: D330037H05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207214
VEGA: 15
Homologene: 19173
Myo18a
Name: myosin XVIIIA
Synonyms: MyoPDZ
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 360013
Homologene: 7977
Ddx46
Name: DEAD box helicase 46
Synonyms: 2200005K02Rik, 8430438J23Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212880
VEGA: 13
Homologene: 5430
Tlk1
Name: tousled-like kinase 1
Synonyms: 4930545J15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228012
Homologene: 130657
Hip1
Name: huntingtin interacting protein 1
Synonyms: 2610109B09Rik, A930014B11Rik, E130315I21Rik, HIP-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215114
HGNC: HGNC:4913
Homologene: 68463
Dsg4
Name: desmoglein 4
Synonyms: lah, CDHF13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16769
Homologene: 65341
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Ptk7
Name: PTK7 protein tyrosine kinase 7
Synonyms: 8430404F20Rik, mPTK7/CCK4, chz
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71461
VEGA: 17
HGNC: HGNC:9618
Homologene: 43672
Ablim2
Name: actin-binding LIM protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231148
Homologene: 82366
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Rdh11
Name: retinol dehydrogenase 11
Synonyms: M42C60, 2610319N22Rik, Psdr1, Mdt1, Arsdr1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17252
Homologene: 100724
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: Actvs, a-SMA, 0610041G09Rik, SMalphaA, alphaSMA, SMAalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1537Clo, b2b1565Clo, b2b1154Clo, b2b1134Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Slc22a26
Name: solute carrier family 22 (organic cation transporter), member 26
Synonyms: BC014805
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236149
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Ppp1r9b
Name: protein phosphatase 1, regulatory subunit 9B
Synonyms: neurabin II, spinophilin, Spn, SPL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217124
HGNC: HGNC:9298
Homologene: 32787
Pcdhb22
Name: protocadherin beta 22
Synonyms: Pcdhb15, PcdhbV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93893
HGNC: HGNC:8686
Homologene: 113752
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76422
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Or5b101
Name: olfactory receptor family 5 subfamily B member 101
Synonyms: GA_x6K02T2RE5P-3357666-3356743, MOR202-6, Olfr1453
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258695
HGNC: HGNC:8324
Homologene: 120159
Azin2
Name: antizyme inhibitor 2
Synonyms: 4933429I20Rik, Odcp, AZIN2, Adc
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242669
Homologene: 62172
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211924
HGNC: HGNC:3048
Fggy
Name: FGGY carbohydrate kinase domain containing
Synonyms: 2310009E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75578
Homologene: 49535
Trim30c
Name: tripartite motif-containing 30C
Synonyms: Trim30-2, Gm5598
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434219
Ccdc142
Name: coiled-coil domain containing 142
Synonyms: A230058J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243510
Homologene: 27813
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77018
Homologene: 57111
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77318
VEGA: 13
Homologene: 12674
Klk15
Name: kallikrein related-peptidase 15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317652
Homologene: 77571
Lingo3
Name: leucine rich repeat and Ig domain containing 3
Synonyms: LERN2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237403
VEGA: 10
Homologene: 78065
Epn1
Name: epsin 1
Synonyms: Ibp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13854
Homologene: 32172
Acot8
Name: acyl-CoA thioesterase 8
Synonyms: PTE-2, Pte1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170789
Homologene: 3991
Lrrc30
Name: leucine rich repeat containing 30
Synonyms: LOC240131
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240131
VEGA: 17
Homologene: 33184
Hps4
Name: HPS4, biogenesis of lysosomal organelles complex 3 subunit 2
Synonyms: C130020P05Rik, BLOC-3, 2010205O06Rik, Hermansky-Pudlak syndrome 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192232
Homologene: 11123
Dph3
Name: diphthamine biosynthesis 3
Synonyms: 5730511P15Rik, DELGIP1, DESR1, 2610018L09Rik, Zcsl2, KTI11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105638
Homologene: 44717
9030624G23Rik
Name: RIKEN cDNA 9030624G23 gene
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66808
VEGA: 12
Homologene: 136548
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 136,181,795 bp
  • A to G, chromosome 1 at 181,817,554 bp
  • T to C, chromosome 2 at 70,786,933 bp
  • T to C, chromosome 2 at 122,088,307 bp
  • A to G, chromosome 2 at 164,792,909 bp
  • C to A, chromosome 3 at 130,474,850 bp
  • T to A, chromosome 4 at 95,800,604 bp
  • A to G, chromosome 4 at 128,934,647 bp
  • A to G, chromosome 5 at 35,802,506 bp
  • G to A, chromosome 5 at 112,378,039 bp
  • A to G, chromosome 5 at 135,428,743 bp
  • T to C, chromosome 6 at 83,102,419 bp
  • T to G, chromosome 7 at 5,095,068 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • T to G, chromosome 7 at 104,382,065 bp
  • C to G, chromosome 7 at 120,085,145 bp
  • T to G, chromosome 7 at 128,764,081 bp
  • T to C, chromosome 8 at 85,091,526 bp
  • A to G, chromosome 9 at 95,481,663 bp
  • A to G, chromosome 9 at 107,963,350 bp
  • G to T, chromosome 10 at 80,834,689 bp
  • T to C, chromosome 11 at 77,778,073 bp
  • T to C, chromosome 11 at 94,992,428 bp
  • T to C, chromosome 11 at 104,751,863 bp
  • A to T, chromosome 12 at 24,074,731 bp
  • T to A, chromosome 12 at 79,191,939 bp
  • G to A, chromosome 12 at 118,130,843 bp
  • C to T, chromosome 13 at 55,652,108 bp
  • C to A, chromosome 13 at 81,414,573 bp
  • A to G, chromosome 13 at 112,318,539 bp
  • T to C, chromosome 14 at 31,154,848 bp
  • T to C, chromosome 14 at 32,085,427 bp
  • A to G, chromosome 15 at 28,245,666 bp
  • G to A, chromosome 15 at 85,120,674 bp
  • A to G, chromosome 15 at 99,991,812 bp
  • GCAGCCCTCCATAGGCGCCAGCCCTCCATAGGCGC to GCAGCCCTCCATAGGCGC, chromosome 17 at 12,751,293 bp
  • A to T, chromosome 17 at 46,566,191 bp
  • T to A, chromosome 17 at 66,343,611 bp
  • A to T, chromosome 17 at 67,631,803 bp
  • A to T, chromosome 18 at 20,275,249 bp
  • T to A, chromosome 18 at 20,471,125 bp
  • A to T, chromosome 18 at 37,519,669 bp
  • T to A, chromosome 18 at 37,889,745 bp
  • C to T, chromosome 19 at 7,785,194 bp
  • A to T, chromosome 19 at 13,027,913 bp
  • G to T, chromosome 19 at 34,241,755 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9059 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068885-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.