Strain Name:
C57BL/6J-MtgxR9118Btlr/Mmmh
Stock Number:
068921-MU
Citation ID:
RRID:MMRRC_068921-MU
Other Names:
R9118 (G1)
Major Collection:

Strain Information

Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Dgat1
Name: diacylglycerol O-acyltransferase 1
Synonyms: D15Ertd23e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13350
HGNC: HGNC:2843
Homologene: 7688
Eif4h
Name: eukaryotic translation initiation factor 4H
Synonyms: Wscr1, Eif4h, D5Ertd355e, E430026L18Rik, Wbscr1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22384
Homologene: 32536
Rapsn
Name: receptor-associated protein of the synapse
Synonyms: rapsyn, Raps, 43kDa acetylcholine receptor-associated protein, Nraps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19400
HGNC: HGNC:9863
Homologene: 3708
Septin9
Name: septin 9
Synonyms: SL3-3 integration site 1, Sint1, Msf, MSF1, PNUTL4, Sept9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53860
HGNC: HGNC:7323
Homologene: 90949
Zng1
Name: Zn regulated GTPase metalloprotein activator 1
Synonyms: Zng1, Cbwd1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226043
VEGA: 19
Homologene: 6843
Tnks1bp1
Name: tankyrase 1 binding protein 1
Synonyms: TAB182
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228140
Homologene: 14117
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Slc7a2
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
Synonyms: Tea, Atrc2, Cat2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11988
Homologene: 20659
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1537Clo, b2b1565Clo, b2b1154Clo, b2b1134Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Pcyt2
Name: phosphate cytidylyltransferase 2, ethanolamine
Synonyms: 1110033E03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68671
HGNC: HGNC:8756
Homologene: 2143
Zfp646
Name: zinc finger protein 646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233905
Homologene: 8802
Dnai7
Name: dynein axonemal intermediate chain 7
Synonyms: Las1, A230084G12Rik, Casc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320662
Homologene: 41242
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Synpr
Name: synaptoporin
Synonyms: 1500003F20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72003
Homologene: 11407
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435864
Homologene: 129606
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, SRRP129, CASP11, SIP1, 2610510E10Rik, Sfrs2ip, Srsf2ip
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
Krt2
Name: keratin 2
Synonyms: Krt2-2, Krt2e, Krt2-17
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Ano5
Name: anoctamin 5
Synonyms: Gdd1, Tmem16e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233246
Homologene: 100071
Acaa1b
Name: acetyl-Coenzyme A acyltransferase 1B
Synonyms: thiolase B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235674
HGNC: HGNC:82
Homologene: 91131
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224576
Homologene: 135824
Gabrd
Name: gamma-aminobutyric acid (GABA) A receptor, subunit delta
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14403
HGNC: HGNC:4084
Homologene: 55489
Aifm2
Name: apoptosis-inducing factor, mitochondrion-associated 2
Synonyms: PRG3, D730001I10Rik, 5430437E11Rik, Amid
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71361
Homologene: 6862
Mfap3l
Name: microfibrillar-associated protein 3-like
Synonyms: 5430405D20Rik, NYD-sp9, 4933428A15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71306
Homologene: 11013
Or5an11
Name: olfactory receptor family 5 subfamily AN member 11
Synonyms: GA_x6K02T2LL2P-1028-792, GA_x6K02T057QT-4025-4642, GA_x6K02T03CT6-1-477, MOR214-3, MOR214-3, Olfr245, Olfr232, Olfr235
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258681
Or2y16
Name: olfactory receptor family 2 subfamily Y member 16
Synonyms: GA_x6K02T2QP88-5991012-5990077, MOR256-28, Olfr1388
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258459
Homologene: 74258
Tmed7
Name: transmembrane p24 trafficking protein 7
Synonyms: 5830493P14Rik, 3930401E15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66676
Homologene: 45644
Vmn1r152
Name: vomeronasal 1 receptor 152
Synonyms: Gm8673
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667504
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 152,503,155 bp
  • T to A, chromosome 1 at 188,654,642 bp
  • G to T, chromosome 2 at 85,063,376 bp
  • A to G, chromosome 2 at 91,045,033 bp
  • C to T, chromosome 2 at 91,478,582 bp
  • C to A, chromosome 4 at 155,386,018 bp
  • A to G, chromosome 5 at 108,843,071 bp
  • C to A, chromosome 5 at 134,627,627 bp
  • A to G, chromosome 6 at 145,175,174 bp
  • A to G, chromosome 6 at 145,175,245 bp
  • A to T, chromosome 7 at 22,523,567 bp
  • T to A, chromosome 7 at 51,570,374 bp
  • A to G, chromosome 7 at 127,881,638 bp
  • T to A, chromosome 8 at 40,898,957 bp
  • G to A, chromosome 8 at 60,656,682 bp
  • G to A, chromosome 8 at 84,536,086 bp
  • A to T, chromosome 9 at 105,878,654 bp
  • A to T, chromosome 9 at 119,156,889 bp
  • T to C, chromosome 10 at 44,003,929 bp
  • C to T, chromosome 10 at 61,725,902 bp
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp
  • A to T, chromosome 11 at 49,444,582 bp
  • A to G, chromosome 11 at 117,266,572 bp
  • G to A, chromosome 11 at 120,613,073 bp
  • T to C, chromosome 14 at 13,608,673 bp
  • T to C, chromosome 15 at 4,962,091 bp
  • TGTCCGACTACAACATCGAGACGGCCAAGCGCGTC to TGTC, chromosome 15 at 28,401,848 bp
  • A to T, chromosome 15 at 76,502,518 bp
  • G to A, chromosome 15 at 96,422,005 bp
  • C to T, chromosome 15 at 101,814,541 bp
  • C to A, chromosome 17 at 20,285,405 bp
  • T to C, chromosome 18 at 46,593,271 bp
  • T to C, chromosome 19 at 12,268,899 bp
  • T to C, chromosome 19 at 24,942,684 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9118 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068921-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.