Strain Name:
C57BL/6J-MtgxR9119Btlr/Mmmh
Stock Number:
068922-MU
Citation ID:
RRID:MMRRC_068922-MU
Other Names:
R9119 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
2310061I04Rik
Name: RIKEN cDNA 2310061I04 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69662
Homologene: 17027
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74841
Homologene: 12367
Sfswap
Name: splicing factor SWAP
Synonyms: 6330437E22Rik, 1190005N23Rik, Sfrs8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231769
Homologene: 134548
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100929
Homologene: 7068
Tpr
Name: translocated promoter region, nuclear basket protein
Synonyms: 2610029M07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108989
Homologene: 37753
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Ric8b
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8, Ric-8b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237422
VEGA: 10
Homologene: 23080
Camkmt
Name: calmodulin-lysine N-methyltransferase
Synonyms: 1700106N22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73582
VEGA: 17
Homologene: 11704
Gas2l3
Name: growth arrest-specific 2 like 3
Synonyms: LOC237436, 8430435B07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237436
VEGA: 10
Homologene: 18386
Ap4m1
Name: adaptor-related protein complex AP-4, mu 1
Synonyms: 4930443L05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11781
HGNC: HGNC:574
Homologene: 3467
Fcho1
Name: FCH domain only 1
Synonyms: 3322402E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74015
Homologene: 22869
Nob1
Name: NIN1/RPN12 binding protein 1 homolog
Synonyms: ART-4, Nob1p, 1700021I09Rik, Psmd8bp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67619
Homologene: 31924
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Ceacam18
Name: CEA cell adhesion molecule 18
Synonyms: 2010110O04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72431
Homologene: 48111
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Vmn2r19
Name: vomeronasal 2, receptor 19
Synonyms: EG232358
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232358
Homologene: 84037
Anxa3
Name: annexin A3
Synonyms: Anx3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11745
HGNC: HGNC:541
Homologene: 68445
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218165
VEGA: 13
Homologene: 125376
Psg21
Name: pregnancy-specific beta-1-glycoprotein 21
Synonyms: cea8, 1600019C01Rik, 1600026N13Rik, 1600025N01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72242
Homologene: 110989
Mtnr1a
Name: melatonin receptor 1A
Synonyms: MelR, Mel1a receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17773
HGNC: HGNC:7463
Homologene: 21207
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213234
Homologene: 11661
Gpr137
Name: G protein-coupled receptor 137
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107173
VEGA: 19
Homologene: 10598
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Fbxo40
Name: F-box protein 40
Synonyms: 9830003A13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207215
Homologene: 9459
Utp14b
Name: UTP14B small subunit processome component
Synonyms: jsd, 4932411L21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 195434
Homologene: 78703
Or6b3
Name: olfactory receptor family 6 subfamily B member 3
Synonyms: GA_x6K02T2R7CC-81245243-81246181, MOR103-2, Olfr1414
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 259041
Homologene: 88368
Ggh
Name: gamma-glutamyl hydrolase
Synonyms: gamma-GH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14590
HGNC: HGNC:4248
Homologene: 2881
Tpm4
Name: tropomyosin 4
Synonyms: 2610528G24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 326618
Homologene: 74286
Kpna2rt
Name: karyopherin subunit alpha 2, retrotransposed
Synonyms: Gm10184
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100043906
VEGA: 17
HGNC: HGNC:6395
Ugt2a2
Name: UDP glucuronosyltransferase 2 family, polypeptide A2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 552899
Homologene: 115736
Scgb1c1
Name: secretoglobin, family 1C, member 1
Synonyms: Ryd5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338417
Homologene: 87936
C1ql1
Name: complement component 1, q subcomponent-like 1
Synonyms: C1qrf
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23829
Homologene: 4867
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 78,665,308 bp
  • G to T, chromosome 1 at 92,511,182 bp
  • T to A, chromosome 1 at 150,404,002 bp
  • T to G, chromosome 2 at 17,400,559 bp
  • G to A, chromosome 2 at 135,967,952 bp
  • T to C, chromosome 3 at 75,078,590 bp
  • C to T, chromosome 3 at 108,401,972 bp
  • T to A, chromosome 4 at 20,057,955 bp
  • G to A, chromosome 4 at 143,131,879 bp
  • A to G, chromosome 5 at 87,462,975 bp
  • T to A, chromosome 5 at 96,828,698 bp
  • C to A, chromosome 5 at 129,514,765 bp
  • G to A, chromosome 5 at 130,269,224 bp
  • T to A, chromosome 5 at 138,176,041 bp
  • A to T, chromosome 6 at 23,094,001 bp
  • T to C, chromosome 6 at 73,060,203 bp
  • A to T, chromosome 6 at 115,955,871 bp
  • C to T, chromosome 6 at 123,315,568 bp
  • T to A, chromosome 7 at 4,552,713 bp
  • T to G, chromosome 7 at 18,647,484 bp
  • T to C, chromosome 7 at 43,639,485 bp
  • T to C, chromosome 7 at 110,312,085 bp
  • A to G, chromosome 7 at 140,846,222 bp
  • G to A, chromosome 8 at 45,087,966 bp
  • C to T, chromosome 8 at 71,712,068 bp
  • A to G, chromosome 8 at 72,138,681 bp
  • A to T, chromosome 8 at 80,984,599 bp
  • A to G, chromosome 8 at 107,416,144 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 10 at 82,295,719 bp
  • T to G, chromosome 10 at 84,947,470 bp
  • T to C, chromosome 10 at 89,413,457 bp
  • G to A, chromosome 11 at 8,879,107 bp
  • T to A, chromosome 11 at 102,946,053 bp
  • A to T, chromosome 13 at 40,180,540 bp
  • A to G, chromosome 13 at 81,510,876 bp
  • A to G, chromosome 14 at 118,631,030 bp
  • C to A, chromosome 16 at 36,966,095 bp
  • C to T, chromosome 16 at 94,392,091 bp
  • C to G, chromosome 17 at 35,893,071 bp
  • T to A, chromosome 17 at 85,096,560 bp
  • T to C, chromosome 17 at 89,910,193 bp
  • G to A, chromosome 19 at 6,938,443 bp
  • A to T, chromosome 19 at 48,653,994 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9119 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068922-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.