Strain Name:
C57BL/6J-MtgxR9137Btlr/Mmmh
Stock Number:
068932-MU
Citation ID:
RRID:MMRRC_068932-MU
Other Names:
R9137 (G1)
Major Collection:

Strain Information

Itpk1
Name: inositol 1,3,4-triphosphate 5/6 kinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217837
HGNC: HGNC:6177
Homologene: 8588
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Enah
Name: ENAH actin regulator
Synonyms: Mena, Ndpp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13800
Homologene: 134005
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Katnb1
Name: katanin p80 (WD40-containing) subunit B 1
Synonyms: KAT, 2410003J24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74187
HGNC: HGNC:6217
Homologene: 4302
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Trim66
Name: tripartite motif-containing 66
Synonyms: D7H11orf29, Tif1d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330627
Homologene: 28044
Kif23
Name: kinesin family member 23
Synonyms: 3110001D19Rik, CHO1, MKLP-1, MKLP1, Knsl5, C87313
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71819
VEGA: 9
HGNC: HGNC:6392
Homologene: 11491
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: 1110034C04Rik, Smek1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Fezf1
Name: Fez family zinc finger 1
Synonyms: Zfp312-like, Fez, 3110069A13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73191
Homologene: 19252
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Zfp874a
Name: zinc finger protein 874a
Synonyms: Rslcan15, C330011K17Rik, Zfp874
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238692
Homologene: 135597
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: Nav1.4, mH2, SkM1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110880
Homologene: 283
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Kcna10
Name: potassium voltage-gated channel, shaker-related subfamily, member 10
Synonyms: Kv1.8, Kcna8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242151
HGNC: HGNC:6219
Homologene: 4054
Spata31e2
Name: spermatogenesis associated 31 subfamily E member 2
Synonyms: 4931408C20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210940
Homologene: 86827
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: fmd, mdg, Cchl1a3, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Gas2l2
Name: growth arrest-specific 2 like 2
Synonyms: OTTMUSG00000000934
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237891
Homologene: 16409
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232970
Homologene: 109375
St8sia2
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Synonyms: ST8SiaII, Siat8b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20450
Homologene: 4384
4930562C15Rik
Name: RIKEN cDNA 4930562C15 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78809
Homologene: 53527
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279029
Homologene: 19586
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Or5k3
Name: olfactory receptor family 5 subfamily K member 3
Synonyms: GA_x54KRFPKG5P-55369823-55370749, MOR184-5, Olfr195
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259000
Homologene: 128109
Cmklr1
Name: chemerin chemokine-like receptor 1
Synonyms: Gpcr27, ChemR23
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14747
HGNC: HGNC:2121
Homologene: 129967
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
Ano9
Name: anoctamin 9
Synonyms: 5430425C04Rik, Tp53i5, Trp53i5, Tmem16j
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71345
Homologene: 67083
Spem1
Name: spermatid maturation 1
Synonyms: 1700095G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74288
Homologene: 45717
Sh3bp4
Name: SH3-domain binding protein 4
Synonyms: BOG25
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98402
Homologene: 8726
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Sp140
Name: Sp140 nuclear body protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 434484
Homologene: 128391
Hhla1
Name: HERV-H LTR-associating 1
Synonyms: F930104E18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 654498
HGNC: HGNC:4904
Homologene: 129987
Smtn
Name: smoothelin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29856
Homologene: 8482
Marveld1
Name: MARVEL (membrane-associating) domain containing 1
Synonyms: Mrvldc1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 277010
Homologene: 12881
Msln
Name: mesothelin
Synonyms: megakaryocyte potentiating factor, MPF
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56047
VEGA: 17
HGNC: HGNC:7371
Homologene: 4249
Cyp3a16
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13114
HGNC: HGNC:2638
Homologene: 133568
Cr2
Name: complement receptor 2
Synonyms: CD21, CD35, Cr-1, Cr-2, Cr1, C3DR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Lgi2
Name: leucine-rich repeat LGI family, member 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246316
Homologene: 10048
Cfap61
Name: cilia and flagella associated protein 61
Synonyms: 4930529M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78774
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625109
Homologene: 129606
E330034G19Rik
Name: RIKEN cDNA E330034G19 gene
Synonyms: ZPAC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105418
Sertad2
Name: SERTA domain containing 2
Synonyms: Trip-Br2, Sei2, SEI-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58172
Homologene: 8843
Gabrr2
Name: gamma-aminobutyric acid type A receptor subunit rho 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14409
HGNC: HGNC:4091
Homologene: 20471
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Rarres1
Name: retinoic acid receptor responder (tazarotene induced) 1
Synonyms: 5430417P09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109222
HGNC: HGNC:9867
Homologene: 2166
Klf14
Name: Kruppel-like transcription factor 14
Synonyms: BTEB5, 5330411L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 619665
Homologene: 76469
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 26,685,634 bp
  • C to T, chromosome 1 at 40,543,017 bp
  • T to G, chromosome 1 at 71,259,366 bp
  • T to C, chromosome 1 at 85,642,576 bp
  • T to A, chromosome 1 at 89,144,925 bp
  • A to T, chromosome 1 at 136,069,006 bp
  • A to G, chromosome 1 at 181,911,595 bp
  • A to G, chromosome 1 at 195,168,332 bp
  • T to C, chromosome 2 at 26,950,560 bp
  • T to C, chromosome 2 at 52,260,490 bp
  • A to C, chromosome 2 at 146,200,765 bp
  • T to A, chromosome 3 at 67,515,468 bp
  • G to T, chromosome 3 at 87,971,344 bp
  • G to A, chromosome 3 at 107,195,181 bp
  • A to G, chromosome 3 at 114,061,523 bp
  • T to A, chromosome 4 at 33,095,571 bp
  • T to A, chromosome 5 at 52,538,019 bp
  • T to G, chromosome 5 at 108,148,990 bp
  • G to C, chromosome 5 at 113,613,982 bp
  • A to G, chromosome 5 at 120,557,925 bp
  • A to G, chromosome 5 at 121,358,175 bp
  • A to C, chromosome 5 at 145,469,603 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 23,246,512 bp
  • A to T, chromosome 6 at 30,957,920 bp
  • C to T, chromosome 7 at 24,611,298 bp
  • T to G, chromosome 7 at 73,960,906 bp
  • C to T, chromosome 7 at 109,475,123 bp
  • C to T, chromosome 7 at 141,104,115 bp
  • G to A, chromosome 8 at 95,097,692 bp
  • A to T, chromosome 9 at 61,927,431 bp
  • A to G, chromosome 10 at 14,128,968 bp
  • T to C, chromosome 10 at 86,776,622 bp
  • T to C, chromosome 10 at 130,446,540 bp
  • T to G, chromosome 11 at 3,522,838 bp
  • A to T, chromosome 11 at 20,648,425 bp
  • A to G, chromosome 11 at 69,821,607 bp
  • A to T, chromosome 11 at 80,095,655 bp
  • G to A, chromosome 11 at 83,425,068 bp
  • A to G, chromosome 11 at 106,323,910 bp
  • A to G, chromosome 11 at 115,345,042 bp
  • T to A, chromosome 12 at 101,055,535 bp
  • T to C, chromosome 12 at 102,574,032 bp
  • C to T, chromosome 13 at 49,701,874 bp
  • T to C, chromosome 13 at 67,442,722 bp
  • A to G, chromosome 13 at 81,540,014 bp
  • A to G, chromosome 14 at 24,296,041 bp
  • T to A, chromosome 15 at 6,827,228 bp
  • G to T, chromosome 15 at 65,923,912 bp
  • T to A, chromosome 15 at 68,179,945 bp
  • A to G, chromosome 16 at 4,867,448 bp
  • T to A, chromosome 16 at 59,149,272 bp
  • C to T, chromosome 17 at 25,750,110 bp
  • T to A, chromosome 17 at 58,294,208 bp
  • A to G, chromosome 19 at 42,148,001 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9137 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068932-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.