Strain Name:
C57BL/6J-MtgxR9217Btlr/Mmmh
Stock Number:
069053-MU
Citation ID:
RRID:MMRRC_069053-MU
Other Names:
R9217 (G1)
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Amigo1
Name: adhesion molecule with Ig like domain 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229715
Homologene: 46421
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Wdr47
Name: WD repeat domain 47
Synonyms: 1810073M12Rik, nemitin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99512
Homologene: 8984
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Abll, Arg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Terf1
Name: telomeric repeat binding factor 1
Synonyms: Trf1, Trbf1, Pin2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21749
Homologene: 7570
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Gnb1
Name: guanine nucleotide binding protein (G protein), beta 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14688
HGNC: HGNC:4396
Homologene: 55532
Trappc8
Name: trafficking protein particle complex 8
Synonyms: 5033403J15Rik, D030074E01Rik, Trs85
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75964
VEGA: 18
Homologene: 40993
Sec24a
Name: SEC24 homolog A, COPII coat complex component
Synonyms: 9430090N21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77371
Homologene: 70131
Rffl
Name: ring finger and FYVE like domain containing protein
Synonyms: 4930516L10Rik, fring, rififylin, 1700051E09Rik, Carp-2, Carp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67338
Homologene: 12116
Lrmda
Name: leucine rich melanocyte differentiation associated
Synonyms: Oca7, 1700112E06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76633
Homologene: 49975
Eif2d
Name: eukaryotic translation initiation factor 2D
Synonyms: D1Ertd5e, Lgtn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16865
HGNC: HGNC:6583
Homologene: 38244
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
St7
Name: suppression of tumorigenicity 7
Synonyms: RAY1, HELG, SEN4, TSG7, Fam4a2, 9430001H04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Slc39a4
Name: solute carrier family 39 (zinc transporter), member 4
Synonyms: zip4, 1600025H15Rik, AWMS2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72027
VEGA: 15
Homologene: 15638
Fubp1
Name: far upstream element (FUSE) binding protein 1
Synonyms: FBP, Fubp, Fubp4, 9530027K12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51886
HGNC: HGNC:4004
Homologene: 48253
Cpt1a
Name: carnitine palmitoyltransferase 1a, liver
Synonyms: CPTI, L-CPT I, Cpt1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12894
VEGA: 19
HGNC: HGNC:2328
Homologene: 1413
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: D330024H06Rik, A930031B09Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Iqcd
Name: IQ motif containing D
Synonyms: 4933433C09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75732
Homologene: 49921
Lclat1
Name: lysocardiolipin acyltransferase 1
Synonyms: ALCAT1, AGPAT8, Lycat
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225010
Homologene: 33167
Dcbld1
Name: discoidin, CUB and LCCL domain containing 1
Synonyms: 4631413K11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66686
Homologene: 12010
Riok2
Name: RIO kinase 2
Synonyms: 2010110K24Rik, 2410085M17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67045
VEGA: 17
Homologene: 6760
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Zfp668
Name: zinc finger protein 668
Synonyms: E130018B19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244219
Homologene: 11667
Tnnt1
Name: troponin T1, skeletal, slow
Synonyms: Tnt, skeletal muscle slow-twitch TnT, sTnT, ssTnT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21955
Homologene: 20704
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64580
Homologene: 11208
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Prss43
Name: serine protease 43
Synonyms: LOC272643, Tessp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272643
Homologene: 138484
Abca15
Name: ATP-binding cassette, sub-family A member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320631
Homologene: 87255
Haspin
Name: histone H3 associated protein kinase
Synonyms: Gsg2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14841
Homologene: 49236
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Gucy2e
Name: guanylate cyclase 2e
Synonyms: ROS-GC1, GC-E, GC1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14919
HGNC: HGNC:4689
Homologene: 55442
Evx2
Name: even-skipped homeobox 2
Synonyms: Evx-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14029
HGNC: HGNC:3507
Homologene: 74879
Lrrc15
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74488
Homologene: 26080
Ano5
Name: anoctamin 5
Synonyms: Gdd1, Tmem16e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233246
Homologene: 100071
Map3k21
Name: mitogen-activated protein kinase kinase kinase 21
Synonyms: BC021891
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234878
Homologene: 32778
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Or8c10
Name: olfactory receptor family 8 subfamily C member 10
Synonyms: GA_x6K02T2MYUG-19447-18473, MOR170-14, MOR170-8, GA_x6K02T2PVTD-32060891-32061865, Olfr899, Olfr250
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404312
VEGA: 9
Homologene: 74151
Msln
Name: mesothelin
Synonyms: megakaryocyte potentiating factor, MPF
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56047
VEGA: 17
HGNC: HGNC:7371
Homologene: 4249
Ccdc62
Name: coiled-coil domain containing 62
Synonyms: LOC208908, G1-485-3, repro29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208908
Homologene: 82466
Plcd1
Name: phospholipase C, delta 1
Synonyms: PLC-delta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18799
VEGA: 9
HGNC: HGNC:9060
Homologene: 21252
Lgr5
Name: leucine rich repeat containing G protein coupled receptor 5
Synonyms: Gpr49
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14160
HGNC: HGNC:4504
Homologene: 20807
Chil6
Name: chitinase-like 6
Synonyms: BYm, BC051070
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229688
Homologene: 77638
Setdb2
Name: SET domain, bifurcated 2
Synonyms: LOC239122, KMT1F
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239122
Homologene: 12903
Etfbkmt
Name: electron transfer flavoprotein beta subunit lysine methyltransferase
Synonyms: 4833442J19Rik, Mettl20
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320204
Homologene: 14453
Decr1
Name: 2,4-dienoyl CoA reductase 1, mitochondrial
Synonyms: Decr, Nadph, 1200012F07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67460
HGNC: HGNC:2753
Homologene: 68178
Cd177
Name: CD177 antigen
Synonyms: Pdp3, 1190003K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68891
Homologene: 49628
Jph1
Name: junctophilin 1
Synonyms: mitsugumin72, JP-1, ENSMUSG00000054314
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57339
Homologene: 10761
Fmo6
Name: flavin containing monooxygenase 6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226565
Homologene: 68130
Ermn
Name: ermin, ERM-like protein
Synonyms: A330104H05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77767
Homologene: 12683
A730049H05Rik
Name: RIKEN cDNA A730049H05 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74516
Aga
Name: aspartylglucosaminidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11593
HGNC: HGNC:318
Homologene: 13
Fam222a
Name: family with sequence similarity 222, member A
Synonyms: BC057022
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433940
Homologene: 41895
Klf14
Name: Kruppel-like transcription factor 14
Synonyms: BTEB5, 5330411L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 619665
Homologene: 76469
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 15,813,071 bp (GRCm38)
  • T to A, chromosome 1 at 17,097,408 bp (GRCm38)
  • A to G, chromosome 1 at 131,158,235 bp (GRCm38)
  • A to G, chromosome 1 at 156,625,332 bp (GRCm38)
  • A to T, chromosome 1 at 162,920,477 bp (GRCm38)
  • A to T, chromosome 2 at 24,839,566 bp (GRCm38)
  • T to C, chromosome 2 at 32,213,402 bp (GRCm38)
  • A to T, chromosome 2 at 58,047,998 bp (GRCm38)
  • A to T, chromosome 2 at 74,657,765 bp (GRCm38)
  • A to T, chromosome 2 at 76,744,045 bp (GRCm38)
  • T to A, chromosome 3 at 106,406,095 bp (GRCm38)
  • T to A, chromosome 3 at 108,188,628 bp (GRCm38)
  • T to A, chromosome 3 at 108,618,574 bp (GRCm38)
  • C to T, chromosome 3 at 125,724,736 bp (GRCm38)
  • T to C, chromosome 3 at 152,218,236 bp (GRCm38)
  • G to A, chromosome 4 at 15,930,969 bp (GRCm38)
  • A to T, chromosome 4 at 155,540,576 bp (GRCm38)
  • T to C, chromosome 5 at 114,610,844 bp (GRCm38)
  • C to T, chromosome 5 at 120,600,642 bp (GRCm38)
  • A to G, chromosome 5 at 123,579,378 bp (GRCm38)
  • C to A, chromosome 5 at 123,954,407 bp (GRCm38)
  • G to A, chromosome 5 at 124,076,027 bp (GRCm38)
  • T to A, chromosome 6 at 17,846,272 bp (GRCm38)
  • T to C, chromosome 6 at 30,958,535 bp (GRCm38)
  • T to C, chromosome 6 at 92,831,986 bp (GRCm38)
  • T to C, chromosome 6 at 149,144,165 bp (GRCm38)
  • T to C, chromosome 7 at 4,510,382 bp (GRCm38)
  • A to T, chromosome 7 at 24,746,125 bp (GRCm38)
  • C to A, chromosome 7 at 51,593,667 bp (GRCm38)
  • C to T, chromosome 7 at 96,885,439 bp (GRCm38)
  • A to T, chromosome 7 at 120,388,216 bp (GRCm38)
  • A to C, chromosome 7 at 127,866,632 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • G to A, chromosome 8 at 53,513,592 bp (GRCm38)
  • T to A, chromosome 8 at 125,911,288 bp (GRCm38)
  • A to G, chromosome 9 at 38,367,972 bp (GRCm38)
  • A to T, chromosome 9 at 73,578,433 bp (GRCm38)
  • T to C, chromosome 9 at 110,827,496 bp (GRCm38)
  • T to C, chromosome 9 at 119,072,655 bp (GRCm38)
  • T to A, chromosome 10 at 5,349,324 bp (GRCm38)
  • T to A, chromosome 10 at 52,261,932 bp (GRCm38)
  • T to A, chromosome 10 at 115,587,444 bp (GRCm38)
  • A to G, chromosome 11 at 51,726,504 bp (GRCm38)
  • C to T, chromosome 11 at 69,235,952 bp (GRCm38)
  • A to T, chromosome 11 at 73,136,110 bp (GRCm38)
  • T to C, chromosome 11 at 82,812,807 bp (GRCm38)
  • C to A, chromosome 13 at 13,696,660 bp (GRCm38)
  • G to A, chromosome 13 at 46,681,662 bp (GRCm38)
  • A to G, chromosome 13 at 67,260,234 bp (GRCm38)
  • A to G, chromosome 14 at 22,598,293 bp (GRCm38)
  • C to T, chromosome 14 at 59,409,432 bp (GRCm38)
  • T to A, chromosome 15 at 76,613,926 bp (GRCm38)
  • A to G, chromosome 16 at 30,273,597 bp (GRCm38)
  • T to A, chromosome 16 at 94,429,608 bp (GRCm38)
  • G to C, chromosome 17 at 17,377,795 bp (GRCm38)
  • T to C, chromosome 17 at 25,751,151 bp (GRCm38)
  • T to C, chromosome 17 at 73,187,884 bp (GRCm38)
  • A to G, chromosome 18 at 20,867,765 bp (GRCm38)
  • G to A, chromosome 19 at 3,375,111 bp (GRCm38)
  • G to T, chromosome 19 at 25,409,580 bp (GRCm38)
  • C to T, chromosome 19 at 38,760,107 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9217 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069053-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.